Incidental Mutation 'R5168:Acsl1'
ID397399
Institutional Source Beutler Lab
Gene Symbol Acsl1
Ensembl Gene ENSMUSG00000018796
Gene Nameacyl-CoA synthetase long-chain family member 1
SynonymsFacl2, Acas1
MMRRC Submission 042748-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R5168 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46471037-46536051 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 46513266 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034046] [ENSMUST00000110371] [ENSMUST00000110372] [ENSMUST00000135955] [ENSMUST00000211644]
Predicted Effect probably benign
Transcript: ENSMUST00000034046
SMART Domains Protein: ENSMUSP00000034046
Gene: ENSMUSG00000018796

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 97 564 7.9e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110371
SMART Domains Protein: ENSMUSP00000106000
Gene: ENSMUSG00000018796

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 97 564 4.1e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110372
SMART Domains Protein: ENSMUSP00000106001
Gene: ENSMUSG00000018796

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 101 564 9.7e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128746
Predicted Effect probably benign
Transcript: ENSMUST00000135955
SMART Domains Protein: ENSMUSP00000117546
Gene: ENSMUSG00000018796

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SCOP:d1lci__ 78 137 4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210929
Predicted Effect probably benign
Transcript: ENSMUST00000211644
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a family of acyl coenzyme A synthetase proteins, which convert long chain fatty acids to acyl CoA products via an ATP-dependent pathway. This enzyme is enriched in heart, liver and adipose tissue, where it functions in lipid synthesis and mitochondrial and peroxisomal beta-oxidation. In addition, it is expressed in monocytes and macrophages where it appears to have a functionally distinct role in mediating inflammatory and innate immune responses. A pseudogene of this gene is found on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Liver acyl-CoA levels are reduced when this gene is conditionally knocked out in the liver. Impaired adaptive thermogenesis when this gene is conditionally knocked out in adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,086,070 N478D probably benign Het
Aox1 T A 1: 58,049,402 C116S probably damaging Het
Bag6 T C 17: 35,144,695 L785P probably damaging Het
Calcr T C 6: 3,708,610 N192S probably benign Het
Cntrl T A 2: 35,157,655 L1414H probably damaging Het
Cntrob T A 11: 69,299,990 I849F possibly damaging Het
Col6a3 C T 1: 90,773,639 W2518* probably null Het
Cxcl15 T A 5: 90,795,283 I48K probably damaging Het
Dab2 T C 15: 6,336,443 probably benign Het
Ddx54 A G 5: 120,617,032 E82G probably benign Het
Dock1 T C 7: 135,118,908 W1249R probably damaging Het
Fam205a1 C T 4: 42,851,488 V223I probably damaging Het
Fras1 A C 5: 96,708,757 M2000L probably benign Het
Gm13103 T C 4: 143,853,198 V451A probably benign Het
Gm1966 T C 7: 106,596,847 noncoding transcript Het
Gpr31b A T 17: 13,051,439 I281N probably damaging Het
Haus5 T C 7: 30,657,711 T432A possibly damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Katnal1 A G 5: 148,921,322 M26T possibly damaging Het
Mccc1 C T 3: 35,990,780 W71* probably null Het
Muc6 G A 7: 141,639,559 probably benign Het
Nrbp1 T A 5: 31,250,137 V397D probably damaging Het
Nt5dc1 T A 10: 34,397,240 E187D probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Olfr564 C T 7: 102,804,321 A281V probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ralgapa1 A G 12: 55,758,032 V493A probably benign Het
Ryr2 T C 13: 11,752,321 T1228A probably benign Het
Slc26a3 G A 12: 31,468,554 V674I possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Tacr3 T C 3: 134,829,559 I96T probably damaging Het
Tmem236 T C 2: 14,192,328 probably null Het
Tmem62 T A 2: 120,993,607 N254K probably benign Het
Tmem79 A T 3: 88,333,344 L99Q probably damaging Het
Trav6-5 A T 14: 53,491,516 N78Y probably benign Het
Trim33 C T 3: 103,341,681 Q807* probably null Het
Ugt1a10 A G 1: 88,055,809 T110A probably benign Het
Vcl C T 14: 21,010,102 T603I probably damaging Het
Vps8 A T 16: 21,457,445 T243S probably damaging Het
Vps8 A C 16: 21,533,099 I323L probably benign Het
Zfp746 G C 6: 48,064,395 Q465E possibly damaging Het
Other mutations in Acsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Acsl1 APN 8 46513760 unclassified probably benign
IGL01356:Acsl1 APN 8 46511463 critical splice donor site probably null
IGL02227:Acsl1 APN 8 46534365 missense probably benign 0.40
IGL02812:Acsl1 APN 8 46492836 missense possibly damaging 0.47
IGL03061:Acsl1 APN 8 46508337 missense probably damaging 0.97
IGL03329:Acsl1 APN 8 46492994 missense possibly damaging 0.88
R0019:Acsl1 UTSW 8 46521250 intron probably null
R0190:Acsl1 UTSW 8 46513392 critical splice donor site probably null
R0233:Acsl1 UTSW 8 46513569 unclassified probably benign
R0479:Acsl1 UTSW 8 46531072 missense probably damaging 1.00
R1325:Acsl1 UTSW 8 46513300 missense probably benign
R1930:Acsl1 UTSW 8 46530986 missense probably benign 0.21
R1931:Acsl1 UTSW 8 46530986 missense probably benign 0.21
R2035:Acsl1 UTSW 8 46528584 missense probably damaging 1.00
R2126:Acsl1 UTSW 8 46533626 missense probably benign 0.01
R2167:Acsl1 UTSW 8 46533590 missense possibly damaging 0.91
R3051:Acsl1 UTSW 8 46521337 missense probably benign 0.00
R3052:Acsl1 UTSW 8 46521337 missense probably benign 0.00
R3753:Acsl1 UTSW 8 46513565 unclassified probably benign
R3883:Acsl1 UTSW 8 46527191 missense probably benign 0.19
R3956:Acsl1 UTSW 8 46534458 missense probably damaging 1.00
R4622:Acsl1 UTSW 8 46526373 missense probably benign 0.02
R5012:Acsl1 UTSW 8 46521431 missense probably benign 0.01
R5464:Acsl1 UTSW 8 46505738 missense probably benign
R5678:Acsl1 UTSW 8 46492850 missense probably benign 0.03
R7151:Acsl1 UTSW 8 46513597 missense probably damaging 1.00
R7831:Acsl1 UTSW 8 46519006 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGCAGATTGTTGTATGCAAAC -3'
(R):5'- AAGCCTATACCTAGGGCTATGG -3'

Sequencing Primer
(F):5'- GCAGATTGTTGTATGCAAACTTAAAG -3'
(R):5'- CTATACCTAGGGCTATGGTGGCAC -3'
Posted On2016-07-06