Incidental Mutation 'R5168:Olfr378'
ID397401
Institutional Source Beutler Lab
Gene Symbol Olfr378
Ensembl Gene ENSMUSG00000055971
Gene Nameolfactory receptor 378
SynonymsMOR135-2, GA_x6K02T2P1NL-3586282-3585338
MMRRC Submission 042748-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R5168 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73424609-73428477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73425843 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 47 (I47F)
Ref Sequence ENSEMBL: ENSMUSP00000066971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069790] [ENSMUST00000117349]
Predicted Effect probably benign
Transcript: ENSMUST00000069790
AA Change: I47F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000066971
Gene: ENSMUSG00000055971
AA Change: I47F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.3e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 297 7.9e-6 PFAM
Pfam:7tm_1 41 290 3.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117349
AA Change: I47F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000113524
Gene: ENSMUSG00000084387
AA Change: I47F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 297 7.9e-6 PFAM
Pfam:7tm_1 41 290 3.3e-34 PFAM
Pfam:7tm_4 139 283 2.8e-40 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,086,070 N478D probably benign Het
Acsl1 T A 8: 46,513,266 probably benign Het
Aox1 T A 1: 58,049,402 C116S probably damaging Het
Bag6 T C 17: 35,144,695 L785P probably damaging Het
Calcr T C 6: 3,708,610 N192S probably benign Het
Cntrl T A 2: 35,157,655 L1414H probably damaging Het
Cntrob T A 11: 69,299,990 I849F possibly damaging Het
Col6a3 C T 1: 90,773,639 W2518* probably null Het
Cxcl15 T A 5: 90,795,283 I48K probably damaging Het
Dab2 T C 15: 6,336,443 probably benign Het
Ddx54 A G 5: 120,617,032 E82G probably benign Het
Dock1 T C 7: 135,118,908 W1249R probably damaging Het
Fam205a1 C T 4: 42,851,488 V223I probably damaging Het
Fras1 A C 5: 96,708,757 M2000L probably benign Het
Gm13103 T C 4: 143,853,198 V451A probably benign Het
Gm1966 T C 7: 106,596,847 noncoding transcript Het
Gpr31b A T 17: 13,051,439 I281N probably damaging Het
Haus5 T C 7: 30,657,711 T432A possibly damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Katnal1 A G 5: 148,921,322 M26T possibly damaging Het
Mccc1 C T 3: 35,990,780 W71* probably null Het
Muc6 G A 7: 141,639,559 probably benign Het
Nrbp1 T A 5: 31,250,137 V397D probably damaging Het
Nt5dc1 T A 10: 34,397,240 E187D probably benign Het
Olfr564 C T 7: 102,804,321 A281V probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ralgapa1 A G 12: 55,758,032 V493A probably benign Het
Ryr2 T C 13: 11,752,321 T1228A probably benign Het
Slc26a3 G A 12: 31,468,554 V674I possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Tacr3 T C 3: 134,829,559 I96T probably damaging Het
Tmem236 T C 2: 14,192,328 probably null Het
Tmem62 T A 2: 120,993,607 N254K probably benign Het
Tmem79 A T 3: 88,333,344 L99Q probably damaging Het
Trav6-5 A T 14: 53,491,516 N78Y probably benign Het
Trim33 C T 3: 103,341,681 Q807* probably null Het
Ugt1a10 A G 1: 88,055,809 T110A probably benign Het
Vcl C T 14: 21,010,102 T603I probably damaging Het
Vps8 A T 16: 21,457,445 T243S probably damaging Het
Vps8 A C 16: 21,533,099 I323L probably benign Het
Zfp746 G C 6: 48,064,395 Q465E possibly damaging Het
Other mutations in Olfr378
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01996:Olfr378 APN 11 73425968 missense probably damaging 1.00
IGL02427:Olfr378 APN 11 73425661 missense probably damaging 1.00
IGL03089:Olfr378 APN 11 73425183 missense probably benign
R0443:Olfr378 UTSW 11 73425755 missense probably damaging 1.00
R1497:Olfr378 UTSW 11 73425827 missense possibly damaging 0.88
R2005:Olfr378 UTSW 11 73425239 missense probably damaging 1.00
R2029:Olfr378 UTSW 11 73425362 missense probably benign 0.00
R2140:Olfr378 UTSW 11 73425881 missense probably damaging 0.98
R3551:Olfr378 UTSW 11 73425852 missense probably benign 0.00
R3552:Olfr378 UTSW 11 73425852 missense probably benign 0.00
R4433:Olfr378 UTSW 11 73425711 missense possibly damaging 0.50
R4546:Olfr378 UTSW 11 73425186 missense probably benign 0.23
R4686:Olfr378 UTSW 11 73425438 missense probably benign 0.35
R5567:Olfr378 UTSW 11 73425446 missense probably damaging 1.00
R5755:Olfr378 UTSW 11 73425731 missense probably benign 0.22
R7190:Olfr378 UTSW 11 73425164 missense probably benign 0.07
R7287:Olfr378 UTSW 11 73425843 missense probably benign 0.01
R7404:Olfr378 UTSW 11 73425593 missense probably damaging 1.00
R7462:Olfr378 UTSW 11 73425470 missense probably benign 0.06
R7544:Olfr378 UTSW 11 73425770 missense probably damaging 1.00
X0010:Olfr378 UTSW 11 73425151 missense possibly damaging 0.59
Z1088:Olfr378 UTSW 11 73425105 unclassified probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAGCGGTCATAGGCCATGG -3'
(R):5'- ATTGGGAATGTTAACTGCTGC -3'

Sequencing Primer
(F):5'- GTTTCCAAGGTCTCCAAAATACAG -3'
(R):5'- GAAGAAACCAAACTGTCATC -3'
Posted On2016-07-06