Incidental Mutation 'R5168:Srp68'
ID397403
Institutional Source Beutler Lab
Gene Symbol Srp68
Ensembl Gene ENSMUSG00000020780
Gene Namesignal recognition particle 68
Synonyms2610024I03Rik
MMRRC Submission 042748-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R5168 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116245166-116274217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 116265474 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 147 (E147D)
Ref Sequence ENSEMBL: ENSMUSP00000021133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021133] [ENSMUST00000106425]
Predicted Effect probably damaging
Transcript: ENSMUST00000021133
AA Change: E147D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021133
Gene: ENSMUSG00000020780
AA Change: E147D

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
Pfam:SRP68 74 596 5.5e-156 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106425
AA Change: E109D

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102033
Gene: ENSMUSG00000020780
AA Change: E109D

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
PDB:4P3F|B 46 215 1e-112 PDB
Blast:TPR 149 182 5e-15 BLAST
Blast:TPR 424 457 1e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128808
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the signal recognition particle (SRP). The SRP is a ribonucleoprotein complex that transports secreted and membrane proteins to the endoplasmic reticulum for processing. The complex includes a 7S RNA and six protein subunits. The encoded protein is the 68kDa component of the SRP, and forms a heterodimer with the 72kDa subunit that is required for SRP function. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and three pseudogenes of this gene are located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,086,070 N478D probably benign Het
Acsl1 T A 8: 46,513,266 probably benign Het
Aox1 T A 1: 58,049,402 C116S probably damaging Het
Bag6 T C 17: 35,144,695 L785P probably damaging Het
Calcr T C 6: 3,708,610 N192S probably benign Het
Cntrl T A 2: 35,157,655 L1414H probably damaging Het
Cntrob T A 11: 69,299,990 I849F possibly damaging Het
Col6a3 C T 1: 90,773,639 W2518* probably null Het
Cxcl15 T A 5: 90,795,283 I48K probably damaging Het
Dab2 T C 15: 6,336,443 probably benign Het
Ddx54 A G 5: 120,617,032 E82G probably benign Het
Dock1 T C 7: 135,118,908 W1249R probably damaging Het
Fam205a1 C T 4: 42,851,488 V223I probably damaging Het
Fras1 A C 5: 96,708,757 M2000L probably benign Het
Gm13103 T C 4: 143,853,198 V451A probably benign Het
Gm1966 T C 7: 106,596,847 noncoding transcript Het
Gpr31b A T 17: 13,051,439 I281N probably damaging Het
Haus5 T C 7: 30,657,711 T432A possibly damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Katnal1 A G 5: 148,921,322 M26T possibly damaging Het
Mccc1 C T 3: 35,990,780 W71* probably null Het
Muc6 G A 7: 141,639,559 probably benign Het
Nrbp1 T A 5: 31,250,137 V397D probably damaging Het
Nt5dc1 T A 10: 34,397,240 E187D probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Olfr564 C T 7: 102,804,321 A281V probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ralgapa1 A G 12: 55,758,032 V493A probably benign Het
Ryr2 T C 13: 11,752,321 T1228A probably benign Het
Slc26a3 G A 12: 31,468,554 V674I possibly damaging Het
Tacr3 T C 3: 134,829,559 I96T probably damaging Het
Tmem236 T C 2: 14,192,328 probably null Het
Tmem62 T A 2: 120,993,607 N254K probably benign Het
Tmem79 A T 3: 88,333,344 L99Q probably damaging Het
Trav6-5 A T 14: 53,491,516 N78Y probably benign Het
Trim33 C T 3: 103,341,681 Q807* probably null Het
Ugt1a10 A G 1: 88,055,809 T110A probably benign Het
Vcl C T 14: 21,010,102 T603I probably damaging Het
Vps8 A T 16: 21,457,445 T243S probably damaging Het
Vps8 A C 16: 21,533,099 I323L probably benign Het
Zfp746 G C 6: 48,064,395 Q465E possibly damaging Het
Other mutations in Srp68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Srp68 APN 11 116247812 splice site probably benign
IGL02974:Srp68 APN 11 116246225 missense probably benign 0.31
tipsy UTSW 11 116245812 missense probably damaging 1.00
P0028:Srp68 UTSW 11 116260920 missense probably damaging 0.99
R0211:Srp68 UTSW 11 116265551 missense probably damaging 1.00
R0211:Srp68 UTSW 11 116265551 missense probably damaging 1.00
R0468:Srp68 UTSW 11 116248764 missense probably damaging 0.98
R0796:Srp68 UTSW 11 116246683 missense probably benign 0.12
R1291:Srp68 UTSW 11 116263281 missense probably damaging 1.00
R1906:Srp68 UTSW 11 116250761 missense probably damaging 1.00
R2149:Srp68 UTSW 11 116260867 missense possibly damaging 0.93
R3732:Srp68 UTSW 11 116273956 nonsense probably null
R4651:Srp68 UTSW 11 116274014 missense probably benign
R4652:Srp68 UTSW 11 116274014 missense probably benign
R4686:Srp68 UTSW 11 116265401 missense probably damaging 0.98
R4924:Srp68 UTSW 11 116260858 missense probably damaging 1.00
R5077:Srp68 UTSW 11 116245812 missense probably damaging 1.00
R5095:Srp68 UTSW 11 116248747 missense probably damaging 0.98
R5166:Srp68 UTSW 11 116265474 missense probably damaging 0.99
R5167:Srp68 UTSW 11 116265474 missense probably damaging 0.99
R5769:Srp68 UTSW 11 116246669 missense probably damaging 1.00
R6379:Srp68 UTSW 11 116265401 missense probably damaging 1.00
R6577:Srp68 UTSW 11 116265464 missense probably damaging 1.00
R6777:Srp68 UTSW 11 116262904 missense probably damaging 1.00
R7089:Srp68 UTSW 11 116271907 splice site probably null
R7561:Srp68 UTSW 11 116248767 missense probably damaging 0.99
R7823:Srp68 UTSW 11 116265439 missense probably damaging 1.00
R7854:Srp68 UTSW 11 116254083 splice site probably null
R8206:Srp68 UTSW 11 116273983 missense probably damaging 0.98
R8407:Srp68 UTSW 11 116252763 missense probably benign 0.00
Z1088:Srp68 UTSW 11 116274035 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TAAGACACTGCTCTGTTTAGTTGC -3'
(R):5'- CAGAGATGCTGTTCTGGGAG -3'

Sequencing Primer
(F):5'- ACACTGCTCTGTTTAGTTGCATTTTG -3'
(R):5'- ATGCTGTTCTGGGAGGAGTCC -3'
Posted On2016-07-06