Incidental Mutation 'R5168:Slc26a3'
ID397404
Institutional Source Beutler Lab
Gene Symbol Slc26a3
Ensembl Gene ENSMUSG00000001225
Gene Namesolute carrier family 26, member 3
Synonyms9030623B18Rik, 9130013M11Rik, Dra
MMRRC Submission 042748-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock #R5168 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31390871-31473917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31468554 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 674 (V674I)
Ref Sequence ENSEMBL: ENSMUSP00000001254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001254] [ENSMUST00000171616]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001254
AA Change: V674I

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000001254
Gene: ENSMUSG00000001225
AA Change: V674I

DomainStartEndE-ValueType
Pfam:Sulfate_transp 73 468 3.1e-115 PFAM
low complexity region 475 481 N/A INTRINSIC
Pfam:STAS 519 709 2e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109275
Predicted Effect probably benign
Transcript: ENSMUST00000171616
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes a member of the solute carrier/sulfate transporter family. The encoded protein is predominantly expressed in the intestine where it is essential for chloride absorption. Disruption of this gene results in chloride-rich diarrhea and compensatory up-regulation of ion-absorbing transporters. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a null allele display partial postnatal lethality; survivors are small and show lower luminal Cl-/HCO3- exchange activity, acidic chloridorrhea, volume depletion, upregulation of ion transporters, dilated colons, higher crypt proliferation and plasma aldosterone, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,086,070 N478D probably benign Het
Acsl1 T A 8: 46,513,266 probably benign Het
Aox1 T A 1: 58,049,402 C116S probably damaging Het
Bag6 T C 17: 35,144,695 L785P probably damaging Het
Calcr T C 6: 3,708,610 N192S probably benign Het
Cntrl T A 2: 35,157,655 L1414H probably damaging Het
Cntrob T A 11: 69,299,990 I849F possibly damaging Het
Col6a3 C T 1: 90,773,639 W2518* probably null Het
Cxcl15 T A 5: 90,795,283 I48K probably damaging Het
Dab2 T C 15: 6,336,443 probably benign Het
Ddx54 A G 5: 120,617,032 E82G probably benign Het
Dock1 T C 7: 135,118,908 W1249R probably damaging Het
Fam205a1 C T 4: 42,851,488 V223I probably damaging Het
Fras1 A C 5: 96,708,757 M2000L probably benign Het
Gm13103 T C 4: 143,853,198 V451A probably benign Het
Gm1966 T C 7: 106,596,847 noncoding transcript Het
Gpr31b A T 17: 13,051,439 I281N probably damaging Het
Haus5 T C 7: 30,657,711 T432A possibly damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Katnal1 A G 5: 148,921,322 M26T possibly damaging Het
Mccc1 C T 3: 35,990,780 W71* probably null Het
Muc6 G A 7: 141,639,559 probably benign Het
Nrbp1 T A 5: 31,250,137 V397D probably damaging Het
Nt5dc1 T A 10: 34,397,240 E187D probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Olfr564 C T 7: 102,804,321 A281V probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ralgapa1 A G 12: 55,758,032 V493A probably benign Het
Ryr2 T C 13: 11,752,321 T1228A probably benign Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Tacr3 T C 3: 134,829,559 I96T probably damaging Het
Tmem236 T C 2: 14,192,328 probably null Het
Tmem62 T A 2: 120,993,607 N254K probably benign Het
Tmem79 A T 3: 88,333,344 L99Q probably damaging Het
Trav6-5 A T 14: 53,491,516 N78Y probably benign Het
Trim33 C T 3: 103,341,681 Q807* probably null Het
Ugt1a10 A G 1: 88,055,809 T110A probably benign Het
Vcl C T 14: 21,010,102 T603I probably damaging Het
Vps8 A T 16: 21,457,445 T243S probably damaging Het
Vps8 A C 16: 21,533,099 I323L probably benign Het
Zfp746 G C 6: 48,064,395 Q465E possibly damaging Het
Other mutations in Slc26a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Slc26a3 APN 12 31452491 splice site probably benign
IGL01717:Slc26a3 APN 12 31463477 missense probably benign 0.11
IGL02151:Slc26a3 APN 12 31447831 missense probably damaging 0.99
IGL02374:Slc26a3 APN 12 31470833 splice site probably benign
IGL02445:Slc26a3 APN 12 31457052 missense possibly damaging 0.65
IGL02526:Slc26a3 APN 12 31457096 missense probably damaging 1.00
IGL02831:Slc26a3 APN 12 31452629 missense probably damaging 1.00
PIT4486001:Slc26a3 UTSW 12 31470950 missense probably benign 0.01
R0422:Slc26a3 UTSW 12 31465849 missense possibly damaging 0.90
R0544:Slc26a3 UTSW 12 31447740 missense probably benign
R0781:Slc26a3 UTSW 12 31465813 missense possibly damaging 0.90
R1561:Slc26a3 UTSW 12 31466452 missense probably benign 0.18
R1860:Slc26a3 UTSW 12 31465846 missense probably benign
R1954:Slc26a3 UTSW 12 31450816 missense probably damaging 0.98
R1967:Slc26a3 UTSW 12 31465778 missense probably damaging 0.99
R2240:Slc26a3 UTSW 12 31457072 missense probably damaging 1.00
R2508:Slc26a3 UTSW 12 31470903 missense probably damaging 0.99
R3894:Slc26a3 UTSW 12 31464720 missense probably damaging 1.00
R3914:Slc26a3 UTSW 12 31453906 missense probably benign 0.00
R3978:Slc26a3 UTSW 12 31465860 splice site probably null
R4701:Slc26a3 UTSW 12 31447774 missense probably damaging 1.00
R4713:Slc26a3 UTSW 12 31457080 missense possibly damaging 0.75
R5024:Slc26a3 UTSW 12 31453908 missense probably benign
R5058:Slc26a3 UTSW 12 31470965 missense possibly damaging 0.66
R5361:Slc26a3 UTSW 12 31450981 critical splice donor site probably null
R5715:Slc26a3 UTSW 12 31448843 critical splice donor site probably null
R5951:Slc26a3 UTSW 12 31452715 intron probably benign
R6662:Slc26a3 UTSW 12 31457346 nonsense probably null
R6895:Slc26a3 UTSW 12 31463524 missense probably damaging 0.96
R7069:Slc26a3 UTSW 12 31450935 missense probably damaging 0.96
R7484:Slc26a3 UTSW 12 31447788 missense probably benign 0.22
R7744:Slc26a3 UTSW 12 31463465 critical splice acceptor site probably null
R8192:Slc26a3 UTSW 12 31468542 missense probably benign 0.05
R8327:Slc26a3 UTSW 12 31466431 missense possibly damaging 0.81
R8371:Slc26a3 UTSW 12 31452542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTCTAGCCATTTCCACAGAAC -3'
(R):5'- TTAACGGAACTTGGGCTGGG -3'

Sequencing Primer
(F):5'- AGCATAATCAGAGGTGATCTTGTG -3'
(R):5'- AGTCACATGAGGCCCTGG -3'
Posted On2016-07-06