Mutagenetix > Incidental Mutations

Incidental Mutation 'R5168:Vps8'

397410

Institutional Source

Beutler Lab

Gene Symbol

Vps8

Ensembl Gene

ENSMUSG00000033653

Gene Name

VPS8 CORVET complex subunit

Synonyms

MMRRC Submission

042748-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5168 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21423118-21644680 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 21457445 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 243 (T243S)

Ref Sequence

ENSEMBL: ENSMUSP00000112937 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096191] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118923] [ENSMUST00000122235]

Predicted Effect

probably damaging
Transcript: ENSMUST00000096191
AA Change: T243S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000093905
Gene: ENSMUSG00000033653
AA Change: T243S

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	296	1e-8	SMART
Blast:WD40	184	225	7e-22	BLAST
Blast:WD40	228	268	5e-20	BLAST
Pfam:Vps8	610	794	1.7e-61	PFAM
low complexity region	992	1007	N/A	INTRINSIC
low complexity region	1085	1097	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
Blast:RING	1257	1277	1e-5	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000096192
AA Change: T245S

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653
AA Change: T245S

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	1e-8	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	612	796	1.4e-61	PFAM
low complexity region	969	979	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1098	1109	N/A	INTRINSIC
RING	1229	1280	1.23e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115397
AA Change: T245S

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653
AA Change: T245S

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	8e-9	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	613	796	1.3e-61	PFAM
low complexity region	994	1009	N/A	INTRINSIC
low complexity region	1087	1099	N/A	INTRINSIC
low complexity region	1128	1139	N/A	INTRINSIC
RING	1259	1310	1.23e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000117598
AA Change: T243S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653
AA Change: T243S

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	296	1e-8	SMART
Blast:WD40	184	225	8e-22	BLAST
Blast:WD40	228	268	5e-20	BLAST
Pfam:Vps8	610	794	1.9e-61	PFAM
low complexity region	992	1007	N/A	INTRINSIC
low complexity region	1085	1097	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
RING	1257	1308	1.23e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118923
AA Change: T245S

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653
AA Change: T245S

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	9e-9	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	612	796	1.9e-61	PFAM
low complexity region	969	979	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1098	1109	N/A	INTRINSIC
RING	1229	1280	1.23e-4	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000122235
AA Change: T243S

SMART Domains

Protein: ENSMUSP00000112622
Gene: ENSMUSG00000033653
AA Change: T243S

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
WD40	184	225	2.66e0	SMART
WD40	228	269	5.5e1	SMART
low complexity region	371	386	N/A	INTRINSIC
low complexity region	480	491	N/A	INTRINSIC

Meta Mutation Damage Score

0.1774

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

96% (47/49)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	T	C	4: 53,086,070	N478D	probably benign	Het
Acsl1	T	A	8: 46,513,266		probably benign	Het
Aox1	T	A	1: 58,049,402	C116S	probably damaging	Het
Bag6	T	C	17: 35,144,695	L785P	probably damaging	Het
Calcr	T	C	6: 3,708,610	N192S	probably benign	Het
Cntrl	T	A	2: 35,157,655	L1414H	probably damaging	Het
Cntrob	T	A	11: 69,299,990	I849F	possibly damaging	Het
Col6a3	C	T	1: 90,773,639	W2518*	probably null	Het
Cxcl15	T	A	5: 90,795,283	I48K	probably damaging	Het
Dab2	T	C	15: 6,336,443		probably benign	Het
Ddx54	A	G	5: 120,617,032	E82G	probably benign	Het
Dock1	T	C	7: 135,118,908	W1249R	probably damaging	Het
Fam205a1	C	T	4: 42,851,488	V223I	probably damaging	Het
Fras1	A	C	5: 96,708,757	M2000L	probably benign	Het
Gm13103	T	C	4: 143,853,198	V451A	probably benign	Het
Gm1966	T	C	7: 106,596,847		noncoding transcript	Het
Gpr31b	A	T	17: 13,051,439	I281N	probably damaging	Het
Haus5	T	C	7: 30,657,711	T432A	possibly damaging	Het
Hecw2	A	G	1: 53,913,300	S925P	probably damaging	Het
Katnal1	A	G	5: 148,921,322	M26T	possibly damaging	Het
Mccc1	C	T	3: 35,990,780	W71*	probably null	Het
Muc6	G	A	7: 141,639,559		probably benign	Het
Nrbp1	T	A	5: 31,250,137	V397D	probably damaging	Het
Nt5dc1	T	A	10: 34,397,240	E187D	probably benign	Het
Olfr378	T	A	11: 73,425,843	I47F	probably benign	Het
Olfr564	C	T	7: 102,804,321	A281V	probably benign	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ralgapa1	A	G	12: 55,758,032	V493A	probably benign	Het
Ryr2	T	C	13: 11,752,321	T1228A	probably benign	Het
Slc26a3	G	A	12: 31,468,554	V674I	possibly damaging	Het
Srp68	C	A	11: 116,265,474	E147D	probably damaging	Het
Tacr3	T	C	3: 134,829,559	I96T	probably damaging	Het
Tmem236	T	C	2: 14,192,328		probably null	Het
Tmem62	T	A	2: 120,993,607	N254K	probably benign	Het
Tmem79	A	T	3: 88,333,344	L99Q	probably damaging	Het
Trav6-5	A	T	14: 53,491,516	N78Y	probably benign	Het
Trim33	C	T	3: 103,341,681	Q807*	probably null	Het
Ugt1a10	A	G	1: 88,055,809	T110A	probably benign	Het
Vcl	C	T	14: 21,010,102	T603I	probably damaging	Het
Zfp746	G	C	6: 48,064,395	Q465E	possibly damaging	Het

Other mutations in Vps8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Vps8	APN	16	21442334	missense	possibly damaging	0.47
IGL00596:Vps8	APN	16	21448412	splice site	probably benign
IGL00985:Vps8	APN	16	21477584	splice site	probably benign
IGL01356:Vps8	APN	16	21517357	critical splice donor site	probably null
IGL01375:Vps8	APN	16	21559372	nonsense	probably null
IGL01643:Vps8	APN	16	21518222	missense	possibly damaging	0.92
IGL02159:Vps8	APN	16	21466484	missense	possibly damaging	0.69
IGL02214:Vps8	APN	16	21517285	missense	probably damaging	1.00
IGL02465:Vps8	APN	16	21521903	missense	probably damaging	1.00
IGL02651:Vps8	APN	16	21517336	missense	probably damaging	0.99
IGL03174:Vps8	APN	16	21466463	missense	probably damaging	1.00
IGL03337:Vps8	APN	16	21563168	missense	probably benign
IGL03383:Vps8	APN	16	21435823	critical splice donor site	probably null
IGL03402:Vps8	APN	16	21448398	missense	possibly damaging	0.68
empires	UTSW	16	21581548	nonsense	probably null
porky	UTSW	16	21461238	missense	probably benign	0.32
realm	UTSW	16	21545236	intron	probably benign
realms	UTSW	16	21444188	unclassified	probably null
Reich	UTSW	16	21478439	missense	probably benign	0.29
reichen	UTSW	16	21506825	splice site	probably benign
IGL03052:Vps8	UTSW	16	21448365	missense	probably damaging	0.99
PIT4677001:Vps8	UTSW	16	21500334	missense	possibly damaging	0.94
R0066:Vps8	UTSW	16	21477523	missense	possibly damaging	0.77
R0066:Vps8	UTSW	16	21477523	missense	possibly damaging	0.77
R0125:Vps8	UTSW	16	21470154	missense	probably benign	0.00
R0137:Vps8	UTSW	16	21504386	splice site	probably benign
R0362:Vps8	UTSW	16	21608227	intron	probably benign
R0384:Vps8	UTSW	16	21506825	splice site	probably benign
R0492:Vps8	UTSW	16	21442357	missense	probably damaging	1.00
R0525:Vps8	UTSW	16	21540109	critical splice donor site	probably null
R0531:Vps8	UTSW	16	21459811	intron	probably benign
R0605:Vps8	UTSW	16	21559337	missense	probably benign	0.00
R0636:Vps8	UTSW	16	21434933	missense	probably benign	0.32
R0707:Vps8	UTSW	16	21442357	missense	probably damaging	1.00
R0840:Vps8	UTSW	16	21456321	missense	probably damaging	0.99
R1170:Vps8	UTSW	16	21459820	intron	probably benign
R1203:Vps8	UTSW	16	21511557	missense	probably damaging	1.00
R1482:Vps8	UTSW	16	21581598	missense	probably benign	0.00
R1531:Vps8	UTSW	16	21466476	nonsense	probably null
R1642:Vps8	UTSW	16	21581579	missense	probably benign
R1956:Vps8	UTSW	16	21461142	missense	probably damaging	1.00
R2201:Vps8	UTSW	16	21576757	missense	probably damaging	1.00
R2287:Vps8	UTSW	16	21568413	missense	probably damaging	1.00
R2423:Vps8	UTSW	16	21559337	missense	probably benign	0.00
R3151:Vps8	UTSW	16	21442373	missense	probably benign	0.04
R3943:Vps8	UTSW	16	21470123	missense	probably damaging	1.00
R3944:Vps8	UTSW	16	21470123	missense	probably damaging	1.00
R4043:Vps8	UTSW	16	21526396	missense	probably damaging	1.00
R4302:Vps8	UTSW	16	21495914	missense	probably damaging	1.00
R4398:Vps8	UTSW	16	21504466	missense	probably damaging	1.00
R4477:Vps8	UTSW	16	21545236	intron	probably benign
R4478:Vps8	UTSW	16	21545236	intron	probably benign
R4479:Vps8	UTSW	16	21545236	intron	probably benign
R4480:Vps8	UTSW	16	21545236	intron	probably benign
R4571:Vps8	UTSW	16	21435775	missense	probably damaging	1.00
R4653:Vps8	UTSW	16	21500210	missense	probably damaging	1.00
R4664:Vps8	UTSW	16	21444188	unclassified	probably null
R4713:Vps8	UTSW	16	21442439	missense	probably damaging	1.00
R4726:Vps8	UTSW	16	21448404	unclassified	probably null
R4959:Vps8	UTSW	16	21459786	missense	probably damaging	1.00
R4973:Vps8	UTSW	16	21459786	missense	probably damaging	1.00
R4975:Vps8	UTSW	16	21466469	missense	probably damaging	1.00
R4992:Vps8	UTSW	16	21461408	missense	possibly damaging	0.52
R5144:Vps8	UTSW	16	21559353	missense	probably damaging	1.00
R5168:Vps8	UTSW	16	21533099	missense	probably benign	0.05
R5222:Vps8	UTSW	16	21581548	nonsense	probably null
R5231:Vps8	UTSW	16	21576725	missense	probably damaging	1.00
R5876:Vps8	UTSW	16	21461439	critical splice donor site	probably null
R5963:Vps8	UTSW	16	21470121	missense	possibly damaging	0.48
R6010:Vps8	UTSW	16	21545205	intron	probably benign
R6023:Vps8	UTSW	16	21461238	missense	probably benign	0.32
R6173:Vps8	UTSW	16	21495932	splice site	probably null
R6185:Vps8	UTSW	16	21470141	missense	probably damaging	0.98
R6264:Vps8	UTSW	16	21559349	nonsense	probably null
R6409:Vps8	UTSW	16	21478439	missense	probably benign	0.29
R6522:Vps8	UTSW	16	21442379	missense	probably damaging	0.99
R6528:Vps8	UTSW	16	21554125	nonsense	probably null
R6784:Vps8	UTSW	16	21563207	missense	probably benign	0.01
R7040:Vps8	UTSW	16	21575022	missense	probably damaging	1.00
R7072:Vps8	UTSW	16	21581579	missense	probably benign
R7103:Vps8	UTSW	16	21526441	missense	probably damaging	1.00
R7149:Vps8	UTSW	16	21459776	missense	probably damaging	1.00
R7195:Vps8	UTSW	16	21456282	missense	probably damaging	1.00
R7206:Vps8	UTSW	16	21457421	missense	probably damaging	1.00
R7403:Vps8	UTSW	16	21434972	missense	possibly damaging	0.78
R7782:Vps8	UTSW	16	21511558	missense	possibly damaging	0.89
R7806:Vps8	UTSW	16	21459751	missense	probably damaging	1.00
R7846:Vps8	UTSW	16	21532320	missense	probably benign	0.01
R7929:Vps8	UTSW	16	21532320	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCCTGCAATGTTTATAGATGAGG -3'
(R):5'- CTGCTGCCAAACTGAGTTGG -3'

Sequencing Primer
(F):5'- AGATGAGGAATGGGTTATTTCAGCC -3'
(R):5'- GAAGCTGTATATGTTCATACCAGCCC -3'

Posted On

2016-07-06