Incidental Mutation 'R5168:Gpr31b'
ID397412
Institutional Source Beutler Lab
Gene Symbol Gpr31b
Ensembl Gene ENSMUSG00000071311
Gene NameG protein-coupled receptor 31, D17Leh66b region
Synonyms
MMRRC Submission 042748-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5168 (G1)
Quality Score83
Status Not validated
Chromosome17
Chromosomal Location13051321-13052280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13051439 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 281 (I281N)
Ref Sequence ENSEMBL: ENSMUSP00000089237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091648]
Predicted Effect probably damaging
Transcript: ENSMUST00000091648
AA Change: I281N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089237
Gene: ENSMUSG00000071311
AA Change: I281N

DomainStartEndE-ValueType
Pfam:7tm_1 31 282 3.9e-30 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,086,070 N478D probably benign Het
Acsl1 T A 8: 46,513,266 probably benign Het
Aox1 T A 1: 58,049,402 C116S probably damaging Het
Bag6 T C 17: 35,144,695 L785P probably damaging Het
Calcr T C 6: 3,708,610 N192S probably benign Het
Cntrl T A 2: 35,157,655 L1414H probably damaging Het
Cntrob T A 11: 69,299,990 I849F possibly damaging Het
Col6a3 C T 1: 90,773,639 W2518* probably null Het
Cxcl15 T A 5: 90,795,283 I48K probably damaging Het
Dab2 T C 15: 6,336,443 probably benign Het
Ddx54 A G 5: 120,617,032 E82G probably benign Het
Dock1 T C 7: 135,118,908 W1249R probably damaging Het
Fam205a1 C T 4: 42,851,488 V223I probably damaging Het
Fras1 A C 5: 96,708,757 M2000L probably benign Het
Gm13103 T C 4: 143,853,198 V451A probably benign Het
Gm1966 T C 7: 106,596,847 noncoding transcript Het
Haus5 T C 7: 30,657,711 T432A possibly damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Katnal1 A G 5: 148,921,322 M26T possibly damaging Het
Mccc1 C T 3: 35,990,780 W71* probably null Het
Muc6 G A 7: 141,639,559 probably benign Het
Nrbp1 T A 5: 31,250,137 V397D probably damaging Het
Nt5dc1 T A 10: 34,397,240 E187D probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Olfr564 C T 7: 102,804,321 A281V probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ralgapa1 A G 12: 55,758,032 V493A probably benign Het
Ryr2 T C 13: 11,752,321 T1228A probably benign Het
Slc26a3 G A 12: 31,468,554 V674I possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Tacr3 T C 3: 134,829,559 I96T probably damaging Het
Tmem236 T C 2: 14,192,328 probably null Het
Tmem62 T A 2: 120,993,607 N254K probably benign Het
Tmem79 A T 3: 88,333,344 L99Q probably damaging Het
Trav6-5 A T 14: 53,491,516 N78Y probably benign Het
Trim33 C T 3: 103,341,681 Q807* probably null Het
Ugt1a10 A G 1: 88,055,809 T110A probably benign Het
Vcl C T 14: 21,010,102 T603I probably damaging Het
Vps8 A T 16: 21,457,445 T243S probably damaging Het
Vps8 A C 16: 21,533,099 I323L probably benign Het
Zfp746 G C 6: 48,064,395 Q465E possibly damaging Het
Other mutations in Gpr31b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0312:Gpr31b UTSW 17 13051611 missense probably damaging 0.99
R0645:Gpr31b UTSW 17 13052206 nonsense probably null
R5616:Gpr31b UTSW 17 13051944 missense probably damaging 1.00
R6145:Gpr31b UTSW 17 13051379 missense possibly damaging 0.87
R6927:Gpr31b UTSW 17 13051878 missense probably damaging 1.00
R7211:Gpr31b UTSW 17 13052217 missense probably benign 0.00
R7510:Gpr31b UTSW 17 13051670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTACTGTGTCTGGATTCG -3'
(R):5'- TGGTTGCCATAGTGCTGCTAC -3'

Sequencing Primer
(F):5'- CTCCTTATCCTGAGACTATTGGG -3'
(R):5'- CCATAGTGCTGCTACTGTTTGGAC -3'
Posted On2016-07-06