Incidental Mutation 'R5169:Alpk1'
ID397425
Institutional Source Beutler Lab
Gene Symbol Alpk1
Ensembl Gene ENSMUSG00000028028
Gene Namealpha-kinase 1
Synonyms8430410J10Rik
MMRRC Submission 042749-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5169 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location127670310-127780527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127671101 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1176 (I1176N)
Ref Sequence ENSEMBL: ENSMUSP00000143223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029662] [ENSMUST00000198955]
Predicted Effect probably damaging
Transcript: ENSMUST00000029662
AA Change: I1176N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029662
Gene: ENSMUSG00000028028
AA Change: I1176N

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160586
Predicted Effect probably damaging
Transcript: ENSMUST00000198955
AA Change: I1176N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143223
Gene: ENSMUSG00000028028
AA Change: I1176N

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha kinase. Mice which were homozygous for disrupted copies of this gene exhibited coordination defects (PMID: 21208416). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,877,817 Y964* probably null Het
Acsbg2 T C 17: 56,849,913 K375R probably benign Het
Ago4 C A 4: 126,511,727 R415L probably benign Het
AI481877 T A 4: 59,059,618 Y1014F possibly damaging Het
Arhgap25 A T 6: 87,463,270 I465N possibly damaging Het
Arhgef10 A G 8: 14,930,051 D97G possibly damaging Het
Cdc37 T A 9: 21,141,117 M299L probably benign Het
Ddx54 C A 5: 120,623,263 H453Q probably damaging Het
Dip2b T C 15: 100,205,113 Y1102H probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dopey1 T C 9: 86,533,021 F1939L probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ints7 T C 1: 191,613,090 F631L probably benign Het
Itih1 A T 14: 30,933,446 Y597* probably null Het
Kctd1 T C 18: 15,062,765 E267G possibly damaging Het
Lrrc8e A G 8: 4,234,329 T185A probably benign Het
Masp2 T C 4: 148,606,114 I276T probably damaging Het
Med17 A T 9: 15,277,604 F122I probably benign Het
Milr1 C T 11: 106,754,928 R99* probably null Het
Mpp4 T C 1: 59,130,097 probably null Het
Ms4a4d C T 19: 11,557,976 P213S possibly damaging Het
Mtcl1 T C 17: 66,343,823 N1100S probably benign Het
Myom3 T C 4: 135,775,578 I322T probably benign Het
Nav2 C T 7: 49,548,483 Q1287* probably null Het
Nr3c2 A T 8: 76,909,037 N256Y probably damaging Het
Nrde2 A G 12: 100,129,293 probably null Het
Otog G T 7: 46,298,148 A2242S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 T C 3: 49,755,966 D300G possibly damaging Het
Pcdh8 G A 14: 79,767,655 P880S probably benign Het
Pcid2 A G 8: 13,079,632 probably null Het
Phkb A G 8: 85,896,491 H148R probably benign Het
Pik3r4 T C 9: 105,678,161 S1106P probably benign Het
Pnpla7 A T 2: 25,050,309 M1067L probably benign Het
Pp2d1 C A 17: 53,507,902 G598V possibly damaging Het
Ppm1d C T 11: 85,332,370 A267V probably damaging Het
Psg29 C T 7: 17,211,653 P383S probably damaging Het
Rc3h2 A T 2: 37,405,312 F231I probably damaging Het
Rpl14 T A 9: 120,572,188 D32E possibly damaging Het
Rpl32 G T 6: 115,806,988 N92K probably benign Het
Rragc A G 4: 123,935,664 N391S probably damaging Het
Ryr3 C T 2: 112,670,660 E3563K possibly damaging Het
Sh3rf2 A G 18: 42,153,061 M508V probably benign Het
Slc24a3 G A 2: 145,640,264 C614Y probably benign Het
Spata31d1b T C 13: 59,716,495 S486P probably damaging Het
Spi1 A T 2: 91,115,083 K170* probably null Het
Srgn C A 10: 62,495,087 D80Y probably damaging Het
St6galnac6 A G 2: 32,614,845 K87R possibly damaging Het
Sytl3 A T 17: 6,715,546 K134* probably null Het
Szt2 T C 4: 118,389,830 T863A probably benign Het
Tcea3 A T 4: 136,264,870 probably null Het
Tg T A 15: 66,678,780 L253* probably null Het
Timm8a2 T A 14: 122,034,726 S14T probably benign Het
Tmem57 T C 4: 134,828,463 H233R probably benign Het
Tppp3 G C 8: 105,467,869 N166K probably benign Het
Trav2 G A 14: 52,567,302 V4M probably benign Het
Trmt5 T C 12: 73,282,721 D221G probably damaging Het
Ttc27 T A 17: 74,747,695 L332* probably null Het
V1rd19 A G 7: 24,003,784 N225S possibly damaging Het
Wdr20rt A T 12: 65,227,410 Q448L probably damaging Het
Zc3h7b A T 15: 81,773,314 N185I probably benign Het
Zmpste24 A T 4: 121,068,717 I351N probably damaging Het
Other mutations in Alpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Alpk1 APN 3 127681043 missense probably damaging 1.00
IGL00722:Alpk1 APN 3 127680213 missense probably benign 0.00
IGL01066:Alpk1 APN 3 127680225 missense probably benign 0.22
IGL01351:Alpk1 APN 3 127672362 missense probably damaging 0.97
IGL01412:Alpk1 APN 3 127679972 missense possibly damaging 0.60
IGL01469:Alpk1 APN 3 127677752 unclassified probably null
IGL01585:Alpk1 APN 3 127679813 missense probably benign 0.01
IGL02308:Alpk1 APN 3 127729282 missense probably damaging 0.99
IGL02325:Alpk1 APN 3 127679903 missense probably benign 0.43
IGL02458:Alpk1 APN 3 127681319 critical splice donor site probably null
IGL02553:Alpk1 APN 3 127673321 missense probably damaging 1.00
IGL02717:Alpk1 APN 3 127681100 missense possibly damaging 0.76
IGL02729:Alpk1 APN 3 127681072 missense possibly damaging 0.87
IGL02832:Alpk1 APN 3 127679943 missense possibly damaging 0.63
IGL02892:Alpk1 APN 3 127680122 missense possibly damaging 0.92
IGL03178:Alpk1 APN 3 127680221 nonsense probably null
R0427:Alpk1 UTSW 3 127671071 missense probably damaging 1.00
R0981:Alpk1 UTSW 3 127679402 missense possibly damaging 0.62
R1174:Alpk1 UTSW 3 127680810 missense probably damaging 0.99
R1793:Alpk1 UTSW 3 127677798 missense probably damaging 1.00
R1859:Alpk1 UTSW 3 127681100 missense possibly damaging 0.76
R2173:Alpk1 UTSW 3 127683590 missense probably damaging 1.00
R2235:Alpk1 UTSW 3 127680920 missense probably benign 0.01
R2373:Alpk1 UTSW 3 127679808 missense probably benign 0.00
R3803:Alpk1 UTSW 3 127679837 missense possibly damaging 0.93
R3927:Alpk1 UTSW 3 127677716 missense probably damaging 1.00
R4356:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4357:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4358:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4379:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4381:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4470:Alpk1 UTSW 3 127679526 missense probably damaging 1.00
R4471:Alpk1 UTSW 3 127679526 missense probably damaging 1.00
R4473:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4474:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4476:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4512:Alpk1 UTSW 3 127684471 intron probably benign
R4594:Alpk1 UTSW 3 127683554 missense probably damaging 1.00
R4678:Alpk1 UTSW 3 127679858 missense probably damaging 0.99
R4707:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4784:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4785:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4820:Alpk1 UTSW 3 127671059 missense probably benign 0.06
R4887:Alpk1 UTSW 3 127673475 missense probably damaging 1.00
R5088:Alpk1 UTSW 3 127685320 splice site probably benign
R5280:Alpk1 UTSW 3 127681164 missense probably benign 0.00
R5351:Alpk1 UTSW 3 127729292 missense probably damaging 0.96
R5478:Alpk1 UTSW 3 127677719 missense probably damaging 1.00
R5627:Alpk1 UTSW 3 127680647 missense probably damaging 0.99
R5781:Alpk1 UTSW 3 127680035 missense possibly damaging 0.92
R5842:Alpk1 UTSW 3 127680969 missense probably damaging 1.00
R5847:Alpk1 UTSW 3 127680074 missense probably benign 0.06
R5940:Alpk1 UTSW 3 127670946 missense probably benign
R6187:Alpk1 UTSW 3 127673342 missense probably damaging 1.00
R6306:Alpk1 UTSW 3 127686316 missense probably damaging 1.00
R6414:Alpk1 UTSW 3 127680209 missense probably benign
R6701:Alpk1 UTSW 3 127729336 missense probably damaging 1.00
R6735:Alpk1 UTSW 3 127724449 missense probably damaging 1.00
R6850:Alpk1 UTSW 3 127729363 missense possibly damaging 0.87
R7173:Alpk1 UTSW 3 127684375 nonsense probably null
R7258:Alpk1 UTSW 3 127724466 missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127672494 missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127695733 missense probably damaging 1.00
R7498:Alpk1 UTSW 3 127679778 missense probably benign 0.22
R7635:Alpk1 UTSW 3 127695661 missense probably benign 0.01
R7660:Alpk1 UTSW 3 127680967 missense probably damaging 1.00
R7682:Alpk1 UTSW 3 127672546 missense possibly damaging 0.94
R7732:Alpk1 UTSW 3 127684392 missense
R7827:Alpk1 UTSW 3 127680051 missense probably benign 0.00
R8029:Alpk1 UTSW 3 127729285 missense possibly damaging 0.95
Z1176:Alpk1 UTSW 3 127673438 missense probably damaging 1.00
Z1177:Alpk1 UTSW 3 127685307 missense
Predicted Primers PCR Primer
(F):5'- ATGCTAGGCTCTTGAAGTCTTGTC -3'
(R):5'- CACCTCAAATGCCTTGGCAG -3'

Sequencing Primer
(F):5'- AGGCTCTTGAAGTCTTGTCAACTC -3'
(R):5'- TGCCTTGGCAGAAACGTAC -3'
Posted On2016-07-06