Incidental Mutation 'R5169:Phkb'
ID397451
Institutional Source Beutler Lab
Gene Symbol Phkb
Ensembl Gene ENSMUSG00000036879
Gene Namephosphorylase kinase beta
Synonyms
MMRRC Submission 042749-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.698) question?
Stock #R5169 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85840959-86061376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85896491 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 148 (H148R)
Ref Sequence ENSEMBL: ENSMUSP00000125690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053771] [ENSMUST00000160611] [ENSMUST00000161850] [ENSMUST00000162464]
Predicted Effect probably benign
Transcript: ENSMUST00000053771
AA Change: H148R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050788
Gene: ENSMUSG00000036879
AA Change: H148R

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 870 1.5e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159882
Predicted Effect probably benign
Transcript: ENSMUST00000160611
AA Change: H148R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125690
Gene: ENSMUSG00000036879
AA Change: H148R

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 164 3.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161850
AA Change: H156R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124939
Gene: ENSMUSG00000036879
AA Change: H156R

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 47 206 3.9e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162464
AA Change: H148R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125197
Gene: ENSMUSG00000036879
AA Change: H148R

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 163 7.2e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, encoded by this gene, which is a member of the phosphorylase b kinase regulatory subunit family. The gamma subunit also includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9B, also known as phosphorylase kinase deficiency of liver and muscle. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. Two pseudogenes have been found on chromosomes 14 and 20, respectively.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,877,817 Y964* probably null Het
Acsbg2 T C 17: 56,849,913 K375R probably benign Het
Ago4 C A 4: 126,511,727 R415L probably benign Het
AI481877 T A 4: 59,059,618 Y1014F possibly damaging Het
Alpk1 A T 3: 127,671,101 I1176N probably damaging Het
Arhgap25 A T 6: 87,463,270 I465N possibly damaging Het
Arhgef10 A G 8: 14,930,051 D97G possibly damaging Het
Cdc37 T A 9: 21,141,117 M299L probably benign Het
Ddx54 C A 5: 120,623,263 H453Q probably damaging Het
Dip2b T C 15: 100,205,113 Y1102H probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dopey1 T C 9: 86,533,021 F1939L probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ints7 T C 1: 191,613,090 F631L probably benign Het
Itih1 A T 14: 30,933,446 Y597* probably null Het
Kctd1 T C 18: 15,062,765 E267G possibly damaging Het
Lrrc8e A G 8: 4,234,329 T185A probably benign Het
Masp2 T C 4: 148,606,114 I276T probably damaging Het
Med17 A T 9: 15,277,604 F122I probably benign Het
Milr1 C T 11: 106,754,928 R99* probably null Het
Mpp4 T C 1: 59,130,097 probably null Het
Ms4a4d C T 19: 11,557,976 P213S possibly damaging Het
Mtcl1 T C 17: 66,343,823 N1100S probably benign Het
Myom3 T C 4: 135,775,578 I322T probably benign Het
Nav2 C T 7: 49,548,483 Q1287* probably null Het
Nr3c2 A T 8: 76,909,037 N256Y probably damaging Het
Nrde2 A G 12: 100,129,293 probably null Het
Otog G T 7: 46,298,148 A2242S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 T C 3: 49,755,966 D300G possibly damaging Het
Pcdh8 G A 14: 79,767,655 P880S probably benign Het
Pcid2 A G 8: 13,079,632 probably null Het
Pik3r4 T C 9: 105,678,161 S1106P probably benign Het
Pnpla7 A T 2: 25,050,309 M1067L probably benign Het
Pp2d1 C A 17: 53,507,902 G598V possibly damaging Het
Ppm1d C T 11: 85,332,370 A267V probably damaging Het
Psg29 C T 7: 17,211,653 P383S probably damaging Het
Rc3h2 A T 2: 37,405,312 F231I probably damaging Het
Rpl14 T A 9: 120,572,188 D32E possibly damaging Het
Rpl32 G T 6: 115,806,988 N92K probably benign Het
Rragc A G 4: 123,935,664 N391S probably damaging Het
Ryr3 C T 2: 112,670,660 E3563K possibly damaging Het
Sh3rf2 A G 18: 42,153,061 M508V probably benign Het
Slc24a3 G A 2: 145,640,264 C614Y probably benign Het
Spata31d1b T C 13: 59,716,495 S486P probably damaging Het
Spi1 A T 2: 91,115,083 K170* probably null Het
Srgn C A 10: 62,495,087 D80Y probably damaging Het
St6galnac6 A G 2: 32,614,845 K87R possibly damaging Het
Sytl3 A T 17: 6,715,546 K134* probably null Het
Szt2 T C 4: 118,389,830 T863A probably benign Het
Tcea3 A T 4: 136,264,870 probably null Het
Tg T A 15: 66,678,780 L253* probably null Het
Timm8a2 T A 14: 122,034,726 S14T probably benign Het
Tmem57 T C 4: 134,828,463 H233R probably benign Het
Tppp3 G C 8: 105,467,869 N166K probably benign Het
Trav2 G A 14: 52,567,302 V4M probably benign Het
Trmt5 T C 12: 73,282,721 D221G probably damaging Het
Ttc27 T A 17: 74,747,695 L332* probably null Het
V1rd19 A G 7: 24,003,784 N225S possibly damaging Het
Wdr20rt A T 12: 65,227,410 Q448L probably damaging Het
Zc3h7b A T 15: 81,773,314 N185I probably benign Het
Zmpste24 A T 4: 121,068,717 I351N probably damaging Het
Other mutations in Phkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Phkb APN 8 85957587 missense probably benign 0.42
IGL01126:Phkb APN 8 85946101 missense probably benign 0.12
IGL01700:Phkb APN 8 86017465 missense probably benign 0.06
IGL01761:Phkb APN 8 86019064 missense probably benign 0.01
IGL02404:Phkb APN 8 85878115 missense possibly damaging 0.94
IGL02672:Phkb APN 8 85942358 missense probably benign
IGL02682:Phkb APN 8 85875646 makesense probably null
IGL02693:Phkb APN 8 85942234 missense probably damaging 1.00
IGL02798:Phkb APN 8 86043777 missense probably benign
IGL02888:Phkb APN 8 85935472 critical splice donor site probably null
IGL03106:Phkb APN 8 86018466 splice site probably benign
PIT4544001:Phkb UTSW 8 86011637 missense probably benign 0.42
R0088:Phkb UTSW 8 85942391 critical splice donor site probably null
R0107:Phkb UTSW 8 86016931 missense probably benign 0.01
R0504:Phkb UTSW 8 86056524 missense probably benign
R0569:Phkb UTSW 8 86017402 missense probably damaging 1.00
R0671:Phkb UTSW 8 85875693 missense probably damaging 0.97
R0894:Phkb UTSW 8 86017441 missense probably damaging 1.00
R1491:Phkb UTSW 8 85875657 missense possibly damaging 0.90
R1502:Phkb UTSW 8 86059339 missense possibly damaging 0.69
R1595:Phkb UTSW 8 86026553 splice site probably benign
R1686:Phkb UTSW 8 86021649 missense probably benign
R1913:Phkb UTSW 8 85901920 missense possibly damaging 0.95
R1919:Phkb UTSW 8 85922161 missense probably benign 0.17
R1968:Phkb UTSW 8 85970951 missense probably benign 0.07
R2008:Phkb UTSW 8 86056467 missense probably damaging 1.00
R2051:Phkb UTSW 8 86049821 critical splice donor site probably null
R2148:Phkb UTSW 8 86017486 missense probably damaging 0.96
R2305:Phkb UTSW 8 86043802 missense possibly damaging 0.80
R3801:Phkb UTSW 8 85922229 nonsense probably null
R3804:Phkb UTSW 8 85922229 nonsense probably null
R4159:Phkb UTSW 8 86021533 splice site probably null
R4624:Phkb UTSW 8 85848712 intron probably benign
R4833:Phkb UTSW 8 85901911 missense probably damaging 1.00
R5017:Phkb UTSW 8 86049809 missense probably benign
R5337:Phkb UTSW 8 85878245 missense probably damaging 1.00
R5391:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5395:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5480:Phkb UTSW 8 85922182 missense probably damaging 1.00
R5538:Phkb UTSW 8 85922127 missense possibly damaging 0.80
R5623:Phkb UTSW 8 85843048 unclassified probably benign
R5753:Phkb UTSW 8 85878230 missense probably damaging 1.00
R5909:Phkb UTSW 8 86021447 critical splice donor site probably null
R5929:Phkb UTSW 8 85970914 missense probably benign 0.01
R6093:Phkb UTSW 8 85942329 missense probably damaging 1.00
R6320:Phkb UTSW 8 85875698 missense probably benign 0.00
R6324:Phkb UTSW 8 86018542 missense probably benign 0.00
R6626:Phkb UTSW 8 85922151 missense probably damaging 0.96
R6687:Phkb UTSW 8 86029546 missense probably damaging 1.00
R6848:Phkb UTSW 8 86029617 missense probably damaging 0.99
R7228:Phkb UTSW 8 85843007 unclassified probably benign
R7260:Phkb UTSW 8 85878130 missense probably benign 0.07
R7271:Phkb UTSW 8 86043789 missense probably damaging 1.00
R7314:Phkb UTSW 8 85942392 splice site probably null
R7586:Phkb UTSW 8 86029597 missense probably damaging 1.00
R7654:Phkb UTSW 8 85940887 missense possibly damaging 0.91
X0021:Phkb UTSW 8 86029635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATCAAGAGCTTTAGTTTTCC -3'
(R):5'- CTTCAGCCTTACCAGTTACTAATG -3'

Sequencing Primer
(F):5'- CTGGTTCTAGGTCCAACA -3'
(R):5'- ACACTATTTTGAAGCAAGTGGTG -3'
Posted On2016-07-06