Incidental Mutation 'R5169:Ppm1d'
ID397460
Institutional Source Beutler Lab
Gene Symbol Ppm1d
Ensembl Gene ENSMUSG00000020525
Gene Nameprotein phosphatase 1D magnesium-dependent, delta isoform
SynonymsWip1
MMRRC Submission 042749-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5169 (G1)
Quality Score223
Status Not validated
Chromosome11
Chromosomal Location85311244-85347066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85332370 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 267 (A267V)
Ref Sequence ENSEMBL: ENSMUSP00000020835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020835] [ENSMUST00000127717]
Predicted Effect probably damaging
Transcript: ENSMUST00000020835
AA Change: A267V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020835
Gene: ENSMUSG00000020525
AA Change: A267V

DomainStartEndE-ValueType
PP2Cc 1 366 1.4e-76 SMART
PP2C_SIG 78 368 6.09e0 SMART
low complexity region 403 415 N/A INTRINSIC
Blast:PP2Cc 416 476 1e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000127717
AA Change: A122V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115606
Gene: ENSMUSG00000020525
AA Change: A122V

DomainStartEndE-ValueType
PP2Cc 1 170 2.87e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. The expression of this gene is induced in a p53-dependent manner in response to various environmental stresses. While being induced by tumor suppressor protein TP53/p53, this phosphatase negatively regulates the activity of p38 MAP kinase, MAPK/p38, through which it reduces the phosphorylation of p53, and in turn suppresses p53-mediated transcription and apoptosis. This phosphatase thus mediates a feedback regulation of p38-p53 signaling that contributes to growth inhibition and the suppression of stress induced apoptosis. This gene is located in a chromosomal region known to be amplified in breast cancer. The amplification of this gene has been detected in both breast cancer cell line and primary breast tumors, which suggests a role of this gene in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice show some embryonic lethality. Surviving males have variable abnormalities including runting, reproductive organ atrophy with associated reduced fertility, and reduced life span. Both genders have increased susceptibility to viral infection and reduced lymphocyte function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,877,817 Y964* probably null Het
Acsbg2 T C 17: 56,849,913 K375R probably benign Het
Ago4 C A 4: 126,511,727 R415L probably benign Het
AI481877 T A 4: 59,059,618 Y1014F possibly damaging Het
Alpk1 A T 3: 127,671,101 I1176N probably damaging Het
Arhgap25 A T 6: 87,463,270 I465N possibly damaging Het
Arhgef10 A G 8: 14,930,051 D97G possibly damaging Het
Cdc37 T A 9: 21,141,117 M299L probably benign Het
Ddx54 C A 5: 120,623,263 H453Q probably damaging Het
Dip2b T C 15: 100,205,113 Y1102H probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dopey1 T C 9: 86,533,021 F1939L probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ints7 T C 1: 191,613,090 F631L probably benign Het
Itih1 A T 14: 30,933,446 Y597* probably null Het
Kctd1 T C 18: 15,062,765 E267G possibly damaging Het
Lrrc8e A G 8: 4,234,329 T185A probably benign Het
Masp2 T C 4: 148,606,114 I276T probably damaging Het
Med17 A T 9: 15,277,604 F122I probably benign Het
Milr1 C T 11: 106,754,928 R99* probably null Het
Mpp4 T C 1: 59,130,097 probably null Het
Ms4a4d C T 19: 11,557,976 P213S possibly damaging Het
Mtcl1 T C 17: 66,343,823 N1100S probably benign Het
Myom3 T C 4: 135,775,578 I322T probably benign Het
Nav2 C T 7: 49,548,483 Q1287* probably null Het
Nr3c2 A T 8: 76,909,037 N256Y probably damaging Het
Nrde2 A G 12: 100,129,293 probably null Het
Otog G T 7: 46,298,148 A2242S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 T C 3: 49,755,966 D300G possibly damaging Het
Pcdh8 G A 14: 79,767,655 P880S probably benign Het
Pcid2 A G 8: 13,079,632 probably null Het
Phkb A G 8: 85,896,491 H148R probably benign Het
Pik3r4 T C 9: 105,678,161 S1106P probably benign Het
Pnpla7 A T 2: 25,050,309 M1067L probably benign Het
Pp2d1 C A 17: 53,507,902 G598V possibly damaging Het
Psg29 C T 7: 17,211,653 P383S probably damaging Het
Rc3h2 A T 2: 37,405,312 F231I probably damaging Het
Rpl14 T A 9: 120,572,188 D32E possibly damaging Het
Rpl32 G T 6: 115,806,988 N92K probably benign Het
Rragc A G 4: 123,935,664 N391S probably damaging Het
Ryr3 C T 2: 112,670,660 E3563K possibly damaging Het
Sh3rf2 A G 18: 42,153,061 M508V probably benign Het
Slc24a3 G A 2: 145,640,264 C614Y probably benign Het
Spata31d1b T C 13: 59,716,495 S486P probably damaging Het
Spi1 A T 2: 91,115,083 K170* probably null Het
Srgn C A 10: 62,495,087 D80Y probably damaging Het
St6galnac6 A G 2: 32,614,845 K87R possibly damaging Het
Sytl3 A T 17: 6,715,546 K134* probably null Het
Szt2 T C 4: 118,389,830 T863A probably benign Het
Tcea3 A T 4: 136,264,870 probably null Het
Tg T A 15: 66,678,780 L253* probably null Het
Timm8a2 T A 14: 122,034,726 S14T probably benign Het
Tmem57 T C 4: 134,828,463 H233R probably benign Het
Tppp3 G C 8: 105,467,869 N166K probably benign Het
Trav2 G A 14: 52,567,302 V4M probably benign Het
Trmt5 T C 12: 73,282,721 D221G probably damaging Het
Ttc27 T A 17: 74,747,695 L332* probably null Het
V1rd19 A G 7: 24,003,784 N225S possibly damaging Het
Wdr20rt A T 12: 65,227,410 Q448L probably damaging Het
Zc3h7b A T 15: 81,773,314 N185I probably benign Het
Zmpste24 A T 4: 121,068,717 I351N probably damaging Het
Other mutations in Ppm1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Ppm1d APN 11 85327006 missense probably benign 0.04
IGL02351:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02358:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02496:Ppm1d APN 11 85339666 missense possibly damaging 0.51
IGL02667:Ppm1d APN 11 85332285 missense probably damaging 1.00
IGL02885:Ppm1d APN 11 85326944 missense possibly damaging 0.52
IGL03085:Ppm1d APN 11 85337163 missense probably null 0.80
R0114:Ppm1d UTSW 11 85326905 missense probably damaging 1.00
R0606:Ppm1d UTSW 11 85345877 missense probably benign 0.27
R1014:Ppm1d UTSW 11 85337154 missense probably damaging 0.98
R1548:Ppm1d UTSW 11 85339605 missense probably damaging 1.00
R3774:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R3775:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R4025:Ppm1d UTSW 11 85345757 missense probably benign 0.09
R4065:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4067:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4118:Ppm1d UTSW 11 85311582 missense probably benign 0.01
R5384:Ppm1d UTSW 11 85311783 missense probably damaging 0.98
R5861:Ppm1d UTSW 11 85311848 missense possibly damaging 0.70
R5890:Ppm1d UTSW 11 85326908 missense probably damaging 1.00
R6394:Ppm1d UTSW 11 85339672 missense probably benign
R6992:Ppm1d UTSW 11 85332352 missense probably damaging 1.00
R7006:Ppm1d UTSW 11 85337151 missense possibly damaging 0.92
R7297:Ppm1d UTSW 11 85345995 missense probably damaging 1.00
Z1176:Ppm1d UTSW 11 85339573 missense probably benign 0.09
Z1177:Ppm1d UTSW 11 85326963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGAACCTTGGCTTATGATATC -3'
(R):5'- CAGTGCTGAAATACAGGCTTTACC -3'

Sequencing Primer
(F):5'- TCCTAACATGTCAGGCTTAGTTG -3'
(R):5'- ACCTCTTCCCTCGCATTTAAAATAC -3'
Posted On2016-07-06