Incidental Mutation 'R5169:Abcb5'
ID397465
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms9230106F14Rik
MMRRC Submission 042749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R5169 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location118867824-118966421 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 118877817 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 964 (Y964*)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
Predicted Effect probably null
Transcript: ENSMUST00000035515
AA Change: Y964*
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: Y964*

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 T C 17: 56,849,913 K375R probably benign Het
Ago4 C A 4: 126,511,727 R415L probably benign Het
AI481877 T A 4: 59,059,618 Y1014F possibly damaging Het
Alpk1 A T 3: 127,671,101 I1176N probably damaging Het
Arhgap25 A T 6: 87,463,270 I465N possibly damaging Het
Arhgef10 A G 8: 14,930,051 D97G possibly damaging Het
Cdc37 T A 9: 21,141,117 M299L probably benign Het
Ddx54 C A 5: 120,623,263 H453Q probably damaging Het
Dip2b T C 15: 100,205,113 Y1102H probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dopey1 T C 9: 86,533,021 F1939L probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ints7 T C 1: 191,613,090 F631L probably benign Het
Itih1 A T 14: 30,933,446 Y597* probably null Het
Kctd1 T C 18: 15,062,765 E267G possibly damaging Het
Lrrc8e A G 8: 4,234,329 T185A probably benign Het
Masp2 T C 4: 148,606,114 I276T probably damaging Het
Med17 A T 9: 15,277,604 F122I probably benign Het
Milr1 C T 11: 106,754,928 R99* probably null Het
Mpp4 T C 1: 59,130,097 probably null Het
Ms4a4d C T 19: 11,557,976 P213S possibly damaging Het
Mtcl1 T C 17: 66,343,823 N1100S probably benign Het
Myom3 T C 4: 135,775,578 I322T probably benign Het
Nav2 C T 7: 49,548,483 Q1287* probably null Het
Nr3c2 A T 8: 76,909,037 N256Y probably damaging Het
Nrde2 A G 12: 100,129,293 probably null Het
Otog G T 7: 46,298,148 A2242S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 T C 3: 49,755,966 D300G possibly damaging Het
Pcdh8 G A 14: 79,767,655 P880S probably benign Het
Pcid2 A G 8: 13,079,632 probably null Het
Phkb A G 8: 85,896,491 H148R probably benign Het
Pik3r4 T C 9: 105,678,161 S1106P probably benign Het
Pnpla7 A T 2: 25,050,309 M1067L probably benign Het
Pp2d1 C A 17: 53,507,902 G598V possibly damaging Het
Ppm1d C T 11: 85,332,370 A267V probably damaging Het
Psg29 C T 7: 17,211,653 P383S probably damaging Het
Rc3h2 A T 2: 37,405,312 F231I probably damaging Het
Rpl14 T A 9: 120,572,188 D32E possibly damaging Het
Rpl32 G T 6: 115,806,988 N92K probably benign Het
Rragc A G 4: 123,935,664 N391S probably damaging Het
Ryr3 C T 2: 112,670,660 E3563K possibly damaging Het
Sh3rf2 A G 18: 42,153,061 M508V probably benign Het
Slc24a3 G A 2: 145,640,264 C614Y probably benign Het
Spata31d1b T C 13: 59,716,495 S486P probably damaging Het
Spi1 A T 2: 91,115,083 K170* probably null Het
Srgn C A 10: 62,495,087 D80Y probably damaging Het
St6galnac6 A G 2: 32,614,845 K87R possibly damaging Het
Sytl3 A T 17: 6,715,546 K134* probably null Het
Szt2 T C 4: 118,389,830 T863A probably benign Het
Tcea3 A T 4: 136,264,870 probably null Het
Tg T A 15: 66,678,780 L253* probably null Het
Timm8a2 T A 14: 122,034,726 S14T probably benign Het
Tmem57 T C 4: 134,828,463 H233R probably benign Het
Tppp3 G C 8: 105,467,869 N166K probably benign Het
Trav2 G A 14: 52,567,302 V4M probably benign Het
Trmt5 T C 12: 73,282,721 D221G probably damaging Het
Ttc27 T A 17: 74,747,695 L332* probably null Het
V1rd19 A G 7: 24,003,784 N225S possibly damaging Het
Wdr20rt A T 12: 65,227,410 Q448L probably damaging Het
Zc3h7b A T 15: 81,773,314 N185I probably benign Het
Zmpste24 A T 4: 121,068,717 I351N probably damaging Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118890610 missense probably benign 0.03
IGL00092:Abcb5 APN 12 118928695 missense probably benign 0.09
IGL00503:Abcb5 APN 12 118907601 missense probably benign 0.02
IGL00776:Abcb5 APN 12 118919854 missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118886176 missense probably benign
IGL01302:Abcb5 APN 12 118918200 missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118872867 missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118867970 missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118911434 missense probably benign 0.03
IGL01784:Abcb5 APN 12 118890664 missense probably benign 0.14
IGL01967:Abcb5 APN 12 118867972 missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118927358 missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118940680 missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118874755 missense probably benign
IGL02292:Abcb5 APN 12 118918197 missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118940678 missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118906268 splice site probably benign
IGL02685:Abcb5 APN 12 118905947 missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118890685 missense probably benign 0.05
IGL02876:Abcb5 APN 12 118919841 missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118944939 missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118940369 missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118936087 missense probably benign 0.43
IGL03200:Abcb5 APN 12 118965254 splice site probably benign
IGL03407:Abcb5 APN 12 118940376 missense probably benign 0.01
F5770:Abcb5 UTSW 12 118886179 missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118936098 missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118890687 missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118927394 missense probably benign
R0219:Abcb5 UTSW 12 118886150 splice site probably benign
R0312:Abcb5 UTSW 12 118872837 missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118965251 splice site probably benign
R0359:Abcb5 UTSW 12 118940332 missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118877810 missense probably benign 0.03
R0582:Abcb5 UTSW 12 118940412 missense probably benign 0.40
R0815:Abcb5 UTSW 12 118901449 splice site probably benign
R0900:Abcb5 UTSW 12 118940624 missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118906198 missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118932575 missense probably benign 0.36
R1125:Abcb5 UTSW 12 118911547 missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118874762 missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118965329 start gained probably benign
R1726:Abcb5 UTSW 12 118874801 splice site probably null
R1726:Abcb5 UTSW 12 118907532 missense possibly damaging 0.95
R1836:Abcb5 UTSW 12 118867961 missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118907500 splice site probably null
R1976:Abcb5 UTSW 12 118890682 missense probably benign
R2005:Abcb5 UTSW 12 118877827 missense probably benign 0.15
R2068:Abcb5 UTSW 12 118940568 nonsense probably null
R2181:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118867956 missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118872933 missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118874620 missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118901352 splice site probably null
R3919:Abcb5 UTSW 12 118890618 missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118868669 missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118872922 missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118932610 critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118965305 missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118911434 missense probably benign 0.03
R4966:Abcb5 UTSW 12 118886891 intron probably benign
R5327:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R5333:Abcb5 UTSW 12 118867942 missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118867930 missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118887177 missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118911499 missense probably benign
R5416:Abcb5 UTSW 12 118907596 missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118927326 missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118940690 missense probably null 1.00
R5566:Abcb5 UTSW 12 118935967 missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118932613 splice site probably null
R5691:Abcb5 UTSW 12 118927235 missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118918257 missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118927404 missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118868781 nonsense probably null
R5994:Abcb5 UTSW 12 118965260 critical splice donor site probably null
R6295:Abcb5 UTSW 12 118874644 missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118890549 critical splice donor site probably null
R6609:Abcb5 UTSW 12 118928762 missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118944906 missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118901354 splice site probably null
R6870:Abcb5 UTSW 12 118965265 missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118911530 missense probably benign 0.06
R6957:Abcb5 UTSW 12 118907535 missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118927277 missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118931925 missense probably benign 0.00
R7061:Abcb5 UTSW 12 118877774 missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118867876 missense probably benign 0.00
R7239:Abcb5 UTSW 12 118928725 missense probably benign 0.19
R7267:Abcb5 UTSW 12 118952470 missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118911560 missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118867874 missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118918164 missense probably damaging 1.00
V7580:Abcb5 UTSW 12 118886179 missense probably benign 0.07
Z1176:Abcb5 UTSW 12 118918272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTACTCTTCCTTGAGGTGC -3'
(R):5'- CTAACTCCAAGGTTGTTTGGC -3'

Sequencing Primer
(F):5'- AAACTTCTGGCACCTGATCTGAG -3'
(R):5'- TGGCTGTAGAGAGCACCTG -3'
Posted On2016-07-06