Incidental Mutation 'R5169:Trav2'
ID397469
Institutional Source Beutler Lab
Gene Symbol Trav2
Ensembl Gene ENSMUSG00000076759
Gene NameT cell receptor alpha variable 2
SynonymsENSMUSG00000072561
MMRRC Submission 042749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5169 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location52567293-52568051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52567302 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 4 (V4M)
Ref Sequence ENSEMBL: ENSMUSP00000142736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103568] [ENSMUST00000196939]
Predicted Effect probably benign
Transcript: ENSMUST00000103568
AA Change: V4M

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100345
Gene: ENSMUSG00000076759
AA Change: V4M

DomainStartEndE-ValueType
Pfam:V-set 16 108 8.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196939
AA Change: V4M

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142736
Gene: ENSMUSG00000076759
AA Change: V4M

DomainStartEndE-ValueType
Pfam:V-set 17 109 1e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,877,817 Y964* probably null Het
Acsbg2 T C 17: 56,849,913 K375R probably benign Het
Ago4 C A 4: 126,511,727 R415L probably benign Het
AI481877 T A 4: 59,059,618 Y1014F possibly damaging Het
Alpk1 A T 3: 127,671,101 I1176N probably damaging Het
Arhgap25 A T 6: 87,463,270 I465N possibly damaging Het
Arhgef10 A G 8: 14,930,051 D97G possibly damaging Het
Cdc37 T A 9: 21,141,117 M299L probably benign Het
Ddx54 C A 5: 120,623,263 H453Q probably damaging Het
Dip2b T C 15: 100,205,113 Y1102H probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dopey1 T C 9: 86,533,021 F1939L probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ints7 T C 1: 191,613,090 F631L probably benign Het
Itih1 A T 14: 30,933,446 Y597* probably null Het
Kctd1 T C 18: 15,062,765 E267G possibly damaging Het
Lrrc8e A G 8: 4,234,329 T185A probably benign Het
Masp2 T C 4: 148,606,114 I276T probably damaging Het
Med17 A T 9: 15,277,604 F122I probably benign Het
Milr1 C T 11: 106,754,928 R99* probably null Het
Mpp4 T C 1: 59,130,097 probably null Het
Ms4a4d C T 19: 11,557,976 P213S possibly damaging Het
Mtcl1 T C 17: 66,343,823 N1100S probably benign Het
Myom3 T C 4: 135,775,578 I322T probably benign Het
Nav2 C T 7: 49,548,483 Q1287* probably null Het
Nr3c2 A T 8: 76,909,037 N256Y probably damaging Het
Nrde2 A G 12: 100,129,293 probably null Het
Otog G T 7: 46,298,148 A2242S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 T C 3: 49,755,966 D300G possibly damaging Het
Pcdh8 G A 14: 79,767,655 P880S probably benign Het
Pcid2 A G 8: 13,079,632 probably null Het
Phkb A G 8: 85,896,491 H148R probably benign Het
Pik3r4 T C 9: 105,678,161 S1106P probably benign Het
Pnpla7 A T 2: 25,050,309 M1067L probably benign Het
Pp2d1 C A 17: 53,507,902 G598V possibly damaging Het
Ppm1d C T 11: 85,332,370 A267V probably damaging Het
Psg29 C T 7: 17,211,653 P383S probably damaging Het
Rc3h2 A T 2: 37,405,312 F231I probably damaging Het
Rpl14 T A 9: 120,572,188 D32E possibly damaging Het
Rpl32 G T 6: 115,806,988 N92K probably benign Het
Rragc A G 4: 123,935,664 N391S probably damaging Het
Ryr3 C T 2: 112,670,660 E3563K possibly damaging Het
Sh3rf2 A G 18: 42,153,061 M508V probably benign Het
Slc24a3 G A 2: 145,640,264 C614Y probably benign Het
Spata31d1b T C 13: 59,716,495 S486P probably damaging Het
Spi1 A T 2: 91,115,083 K170* probably null Het
Srgn C A 10: 62,495,087 D80Y probably damaging Het
St6galnac6 A G 2: 32,614,845 K87R possibly damaging Het
Sytl3 A T 17: 6,715,546 K134* probably null Het
Szt2 T C 4: 118,389,830 T863A probably benign Het
Tcea3 A T 4: 136,264,870 probably null Het
Tg T A 15: 66,678,780 L253* probably null Het
Timm8a2 T A 14: 122,034,726 S14T probably benign Het
Tmem57 T C 4: 134,828,463 H233R probably benign Het
Tppp3 G C 8: 105,467,869 N166K probably benign Het
Trmt5 T C 12: 73,282,721 D221G probably damaging Het
Ttc27 T A 17: 74,747,695 L332* probably null Het
V1rd19 A G 7: 24,003,784 N225S possibly damaging Het
Wdr20rt A T 12: 65,227,410 Q448L probably damaging Het
Zc3h7b A T 15: 81,773,314 N185I probably benign Het
Zmpste24 A T 4: 121,068,717 I351N probably damaging Het
Other mutations in Trav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03493:Trav2 APN 14 52567288 utr 5 prime probably benign
R5475:Trav2 UTSW 14 52567833 missense probably damaging 0.96
R7854:Trav2 UTSW 14 52567781 nonsense probably null
R7937:Trav2 UTSW 14 52567781 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTGCTGCCCTGCTATTGG -3'
(R):5'- AGTGGCCATAAATACCTTTCCC -3'

Sequencing Primer
(F):5'- GCTGTTCTCTGGGGAGCATACC -3'
(R):5'- CATGCTTCACATAAAGGCTGAG -3'
Posted On2016-07-06