Mutagenetix > Incidental Mutation

Incidental Mutation 'R5169:Dip2b'

397474

Institutional Source

Beutler Lab

Gene Symbol

Dip2b

Ensembl Gene

ENSMUSG00000023026

Gene Name

disco interacting protein 2 homolog B

Synonyms

MMRRC Submission

042749-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.709) question?

Stock #

R5169 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100038664-100219473 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100205113 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1102 (Y1102H)

Ref Sequence

ENSEMBL: ENSMUSP00000023768 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]

AlphaFold

Q3UH60

Predicted Effect

probably damaging
Transcript: ENSMUST00000023768
AA Change: Y1102H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: Y1102H

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	109	584	9.5e-26	PFAM
Pfam:AMP-binding	760	1235	1.2e-52	PFAM
low complexity region	1299	1311	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100203
AA Change: Y1336H

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: Y1336H

Domain	Start	End	E-Value	Type
DMAP_binding	12	130	1e-42	SMART
low complexity region	152	168	N/A	INTRINSIC
low complexity region	181	192	N/A	INTRINSIC
Pfam:AMP-binding	341	817	2e-26	PFAM
Pfam:AMP-binding	993	1468	1.8e-64	PFAM
low complexity region	1532	1544	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108971
AA Change: Y1102H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: Y1102H

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	108	583	9.5e-26	PFAM
Pfam:AMP-binding	759	1234	1.2e-52	PFAM
low complexity region	1298	1310	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135658

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	A	T	12: 118,877,817	Y964*	probably null	Het
Acsbg2	T	C	17: 56,849,913	K375R	probably benign	Het
Ago4	C	A	4: 126,511,727	R415L	probably benign	Het
AI481877	T	A	4: 59,059,618	Y1014F	possibly damaging	Het
Alpk1	A	T	3: 127,671,101	I1176N	probably damaging	Het
Arhgap25	A	T	6: 87,463,270	I465N	possibly damaging	Het
Arhgef10	A	G	8: 14,930,051	D97G	possibly damaging	Het
Cdc37	T	A	9: 21,141,117	M299L	probably benign	Het
Ddx54	C	A	5: 120,623,263	H453Q	probably damaging	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
Dopey1	T	C	9: 86,533,021	F1939L	probably damaging	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Ints7	T	C	1: 191,613,090	F631L	probably benign	Het
Itih1	A	T	14: 30,933,446	Y597*	probably null	Het
Kctd1	T	C	18: 15,062,765	E267G	possibly damaging	Het
Lrrc8e	A	G	8: 4,234,329	T185A	probably benign	Het
Masp2	T	C	4: 148,606,114	I276T	probably damaging	Het
Med17	A	T	9: 15,277,604	F122I	probably benign	Het
Milr1	C	T	11: 106,754,928	R99*	probably null	Het
Mpp4	T	C	1: 59,130,097		probably null	Het
Ms4a4d	C	T	19: 11,557,976	P213S	possibly damaging	Het
Mtcl1	T	C	17: 66,343,823	N1100S	probably benign	Het
Myom3	T	C	4: 135,775,578	I322T	probably benign	Het
Nav2	C	T	7: 49,548,483	Q1287*	probably null	Het
Nr3c2	A	T	8: 76,909,037	N256Y	probably damaging	Het
Nrde2	A	G	12: 100,129,293		probably null	Het
Otog	G	T	7: 46,298,148	A2242S	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdh18	T	C	3: 49,755,966	D300G	possibly damaging	Het
Pcdh8	G	A	14: 79,767,655	P880S	probably benign	Het
Pcid2	A	G	8: 13,079,632		probably null	Het
Phkb	A	G	8: 85,896,491	H148R	probably benign	Het
Pik3r4	T	C	9: 105,678,161	S1106P	probably benign	Het
Pnpla7	A	T	2: 25,050,309	M1067L	probably benign	Het
Pp2d1	C	A	17: 53,507,902	G598V	possibly damaging	Het
Ppm1d	C	T	11: 85,332,370	A267V	probably damaging	Het
Psg29	C	T	7: 17,211,653	P383S	probably damaging	Het
Rc3h2	A	T	2: 37,405,312	F231I	probably damaging	Het
Rpl14	T	A	9: 120,572,188	D32E	possibly damaging	Het
Rpl32	G	T	6: 115,806,988	N92K	probably benign	Het
Rragc	A	G	4: 123,935,664	N391S	probably damaging	Het
Ryr3	C	T	2: 112,670,660	E3563K	possibly damaging	Het
Sh3rf2	A	G	18: 42,153,061	M508V	probably benign	Het
Slc24a3	G	A	2: 145,640,264	C614Y	probably benign	Het
Spata31d1b	T	C	13: 59,716,495	S486P	probably damaging	Het
Spi1	A	T	2: 91,115,083	K170*	probably null	Het
Srgn	C	A	10: 62,495,087	D80Y	probably damaging	Het
St6galnac6	A	G	2: 32,614,845	K87R	possibly damaging	Het
Sytl3	A	T	17: 6,715,546	K134*	probably null	Het
Szt2	T	C	4: 118,389,830	T863A	probably benign	Het
Tcea3	A	T	4: 136,264,870		probably null	Het
Tg	T	A	15: 66,678,780	L253*	probably null	Het
Timm8a2	T	A	14: 122,034,726	S14T	probably benign	Het
Tmem57	T	C	4: 134,828,463	H233R	probably benign	Het
Tppp3	G	C	8: 105,467,869	N166K	probably benign	Het
Trav2	G	A	14: 52,567,302	V4M	probably benign	Het
Trmt5	T	C	12: 73,282,721	D221G	probably damaging	Het
Ttc27	T	A	17: 74,747,695	L332*	probably null	Het
V1rd19	A	G	7: 24,003,784	N225S	possibly damaging	Het
Wdr20rt	A	T	12: 65,227,410	Q448L	probably damaging	Het
Zc3h7b	A	T	15: 81,773,314	N185I	probably benign	Het
Zmpste24	A	T	4: 121,068,717	I351N	probably damaging	Het

Other mutations in Dip2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Dip2b	APN	15	100174501	missense	probably damaging	1.00
IGL01716:Dip2b	APN	15	100209636	missense	probably benign	0.00
IGL01893:Dip2b	APN	15	100171220	splice site	probably benign
IGL01915:Dip2b	APN	15	100178511	missense	probably damaging	1.00
IGL02125:Dip2b	APN	15	100186250	missense	possibly damaging	0.60
IGL02200:Dip2b	APN	15	100151202	missense	possibly damaging	0.93
IGL02506:Dip2b	APN	15	100157281	missense	probably damaging	1.00
IGL02571:Dip2b	APN	15	100157885	missense	possibly damaging	0.93
IGL02706:Dip2b	APN	15	100215311	missense	probably damaging	0.98
IGL02983:Dip2b	APN	15	100132022	missense	possibly damaging	0.81
IGL03120:Dip2b	APN	15	100203127	splice site	probably benign
IGL03181:Dip2b	APN	15	100215207	missense	probably damaging	0.98
IGL03229:Dip2b	APN	15	100207838	splice site	probably benign
IGL03399:Dip2b	APN	15	100175327	missense	possibly damaging	0.63
PIT4131001:Dip2b	UTSW	15	100202352	missense	probably damaging	1.00
R0009:Dip2b	UTSW	15	100169312	missense	probably damaging	1.00
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0092:Dip2b	UTSW	15	100202265	missense	probably damaging	1.00
R0201:Dip2b	UTSW	15	100186147	missense	probably damaging	0.98
R0359:Dip2b	UTSW	15	100211993	missense	probably damaging	0.98
R0390:Dip2b	UTSW	15	100193913	missense	probably damaging	0.99
R0564:Dip2b	UTSW	15	100162719	nonsense	probably null
R0730:Dip2b	UTSW	15	100171651	missense	probably damaging	1.00
R1144:Dip2b	UTSW	15	100154250	missense	probably benign	0.11
R1200:Dip2b	UTSW	15	100209745	missense	probably benign	0.00
R1506:Dip2b	UTSW	15	100183113	missense	probably damaging	1.00
R1750:Dip2b	UTSW	15	100178466	missense	probably benign
R1760:Dip2b	UTSW	15	100212029	missense	probably damaging	1.00
R1773:Dip2b	UTSW	15	100193961	missense	probably benign	0.00
R1812:Dip2b	UTSW	15	100198938	splice site	probably null
R2264:Dip2b	UTSW	15	100203216	missense	probably benign	0.05
R3105:Dip2b	UTSW	15	100142137	nonsense	probably null
R4029:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4030:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4296:Dip2b	UTSW	15	100181336	missense	probably benign
R4392:Dip2b	UTSW	15	100162036	missense	probably damaging	1.00
R4480:Dip2b	UTSW	15	100186301	missense	probably damaging	0.99
R4564:Dip2b	UTSW	15	100157258	nonsense	probably null
R4605:Dip2b	UTSW	15	100209636	missense	probably benign	0.00
R4606:Dip2b	UTSW	15	100215329	missense	possibly damaging	0.91
R4634:Dip2b	UTSW	15	100160491	missense	probably damaging	1.00
R4667:Dip2b	UTSW	15	100151360	missense	probably benign	0.01
R4739:Dip2b	UTSW	15	100207777	missense	probably damaging	0.98
R4826:Dip2b	UTSW	15	100169281	missense	probably damaging	0.99
R4870:Dip2b	UTSW	15	100195784	splice site	probably null
R4877:Dip2b	UTSW	15	100160529	missense	possibly damaging	0.49
R4932:Dip2b	UTSW	15	100171722	missense	probably damaging	1.00
R5009:Dip2b	UTSW	15	100195784	splice site	probably null
R5216:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5218:Dip2b	UTSW	15	100154296	missense	probably benign	0.00
R5274:Dip2b	UTSW	15	100212104	missense	possibly damaging	0.54
R5370:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5420:Dip2b	UTSW	15	100205173	intron	probably benign
R5447:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5670:Dip2b	UTSW	15	100190104	missense	possibly damaging	0.80
R5768:Dip2b	UTSW	15	100157945	missense	probably benign	0.32
R5908:Dip2b	UTSW	15	100151184	missense	possibly damaging	0.93
R5957:Dip2b	UTSW	15	100209694	missense	probably benign	0.03
R5987:Dip2b	UTSW	15	100190079	missense	probably damaging	1.00
R6260:Dip2b	UTSW	15	100162702	missense	probably benign	0.05
R6325:Dip2b	UTSW	15	100154282	missense	probably benign	0.00
R6367:Dip2b	UTSW	15	100115914	missense	possibly damaging	0.50
R6391:Dip2b	UTSW	15	100151276	missense	probably damaging	1.00
R6422:Dip2b	UTSW	15	100199011	missense	probably damaging	0.98
R6818:Dip2b	UTSW	15	100193954	missense	probably benign	0.09
R6922:Dip2b	UTSW	15	100193843	missense	probably benign	0.25
R7002:Dip2b	UTSW	15	100160465	missense	probably benign	0.43
R7076:Dip2b	UTSW	15	100157972	splice site	probably null
R7176:Dip2b	UTSW	15	100169318	missense	probably damaging	1.00
R7255:Dip2b	UTSW	15	100209627	missense	probably benign	0.00
R7463:Dip2b	UTSW	15	100154157	missense	probably benign
R7513:Dip2b	UTSW	15	100207748	splice site	probably null
R7876:Dip2b	UTSW	15	100191041	missense	probably benign	0.02
R8368:Dip2b	UTSW	15	100154243	missense	probably benign	0.00
R9289:Dip2b	UTSW	15	100173271	missense	probably damaging	0.97
R9405:Dip2b	UTSW	15	100195876	missense	probably benign	0.05
R9477:Dip2b	UTSW	15	100038903	missense	probably damaging	1.00
R9485:Dip2b	UTSW	15	100155043	missense	probably benign	0.05
R9533:Dip2b	UTSW	15	100175297	missense	probably benign	0.06
R9581:Dip2b	UTSW	15	100181374	missense	probably damaging	0.99
R9666:Dip2b	UTSW	15	100209580	missense	probably damaging	1.00
X0064:Dip2b	UTSW	15	100115850	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATAGCCAAGAGGTTGCCAGG -3'
(R):5'- TCAATGAAGCAACTGTGAGAACTG -3'

Sequencing Primer
(F):5'- AGAGGTTGCCAGGCCCAAG -3'
(R):5'- TGCATCACCCCTCAAGAT -3'

Posted On

2016-07-06