Incidental Mutation 'R5169:Dip2b'
ID 397474
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 042749-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R5169 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100102994 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1102 (Y1102H)
Ref Sequence ENSEMBL: ENSMUSP00000023768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect probably damaging
Transcript: ENSMUST00000023768
AA Change: Y1102H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: Y1102H

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100203
AA Change: Y1336H

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: Y1336H

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108971
AA Change: Y1102H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: Y1102H

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135658
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,841,552 (GRCm39) Y964* probably null Het
Acsbg2 T C 17: 57,156,913 (GRCm39) K375R probably benign Het
Ago4 C A 4: 126,405,520 (GRCm39) R415L probably benign Het
Alpk1 A T 3: 127,464,750 (GRCm39) I1176N probably damaging Het
Arhgap25 A T 6: 87,440,252 (GRCm39) I465N possibly damaging Het
Arhgef10 A G 8: 14,980,051 (GRCm39) D97G possibly damaging Het
Cdc37 T A 9: 21,052,413 (GRCm39) M299L probably benign Het
Ddx54 C A 5: 120,761,328 (GRCm39) H453Q probably damaging Het
Dmpk C G 7: 18,821,944 (GRCm39) L301V probably benign Het
Dop1a T C 9: 86,415,074 (GRCm39) F1939L probably damaging Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Ints7 T C 1: 191,345,202 (GRCm39) F631L probably benign Het
Itih1 A T 14: 30,655,403 (GRCm39) Y597* probably null Het
Kctd1 T C 18: 15,195,822 (GRCm39) E267G possibly damaging Het
Lrrc8e A G 8: 4,284,329 (GRCm39) T185A probably benign Het
Maco1 T C 4: 134,555,774 (GRCm39) H233R probably benign Het
Masp2 T C 4: 148,690,571 (GRCm39) I276T probably damaging Het
Med17 A T 9: 15,188,900 (GRCm39) F122I probably benign Het
Milr1 C T 11: 106,645,754 (GRCm39) R99* probably null Het
Mpp4 T C 1: 59,169,256 (GRCm39) probably null Het
Ms4a4d C T 19: 11,535,340 (GRCm39) P213S possibly damaging Het
Mtcl1 T C 17: 66,650,818 (GRCm39) N1100S probably benign Het
Myom3 T C 4: 135,502,889 (GRCm39) I322T probably benign Het
Nav2 C T 7: 49,198,231 (GRCm39) Q1287* probably null Het
Nr3c2 A T 8: 77,635,666 (GRCm39) N256Y probably damaging Het
Nrde2 A G 12: 100,095,552 (GRCm39) probably null Het
Otog G T 7: 45,947,572 (GRCm39) A2242S probably benign Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pcdh18 T C 3: 49,710,415 (GRCm39) D300G possibly damaging Het
Pcdh8 G A 14: 80,005,095 (GRCm39) P880S probably benign Het
Pcid2 A G 8: 13,129,632 (GRCm39) probably null Het
Phkb A G 8: 86,623,120 (GRCm39) H148R probably benign Het
Pik3r4 T C 9: 105,555,360 (GRCm39) S1106P probably benign Het
Pnpla7 A T 2: 24,940,321 (GRCm39) M1067L probably benign Het
Pp2d1 C A 17: 53,814,930 (GRCm39) G598V possibly damaging Het
Ppm1d C T 11: 85,223,196 (GRCm39) A267V probably damaging Het
Psg29 C T 7: 16,945,578 (GRCm39) P383S probably damaging Het
Rc3h2 A T 2: 37,295,324 (GRCm39) F231I probably damaging Het
Rpl14 T A 9: 120,401,254 (GRCm39) D32E possibly damaging Het
Rpl32 G T 6: 115,783,949 (GRCm39) N92K probably benign Het
Rragc A G 4: 123,829,457 (GRCm39) N391S probably damaging Het
Ryr3 C T 2: 112,501,005 (GRCm39) E3563K possibly damaging Het
Sh3rf2 A G 18: 42,286,126 (GRCm39) M508V probably benign Het
Shoc1 T A 4: 59,059,618 (GRCm39) Y1014F possibly damaging Het
Slc24a3 G A 2: 145,482,184 (GRCm39) C614Y probably benign Het
Spata31d1b T C 13: 59,864,309 (GRCm39) S486P probably damaging Het
Spi1 A T 2: 90,945,428 (GRCm39) K170* probably null Het
Srgn C A 10: 62,330,866 (GRCm39) D80Y probably damaging Het
St6galnac6 A G 2: 32,504,857 (GRCm39) K87R possibly damaging Het
Sytl3 A T 17: 6,982,945 (GRCm39) K134* probably null Het
Szt2 T C 4: 118,247,027 (GRCm39) T863A probably benign Het
Tcea3 A T 4: 135,992,181 (GRCm39) probably null Het
Tg T A 15: 66,550,629 (GRCm39) L253* probably null Het
Timm8a2 T A 14: 122,272,138 (GRCm39) S14T probably benign Het
Tppp3 G C 8: 106,194,501 (GRCm39) N166K probably benign Het
Trav2 G A 14: 52,804,759 (GRCm39) V4M probably benign Het
Trmt5 T C 12: 73,329,495 (GRCm39) D221G probably damaging Het
Ttc27 T A 17: 75,054,690 (GRCm39) L332* probably null Het
V1rd19 A G 7: 23,703,209 (GRCm39) N225S possibly damaging Het
Wdr20rt A T 12: 65,274,184 (GRCm39) Q448L probably damaging Het
Zc3h7b A T 15: 81,657,515 (GRCm39) N185I probably benign Het
Zmpste24 A T 4: 120,925,914 (GRCm39) I351N probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGCCAAGAGGTTGCCAGG -3'
(R):5'- TCAATGAAGCAACTGTGAGAACTG -3'

Sequencing Primer
(F):5'- AGAGGTTGCCAGGCCCAAG -3'
(R):5'- TGCATCACCCCTCAAGAT -3'
Posted On 2016-07-06