Incidental Mutation 'R5169:Kctd1'
ID 397480
Institutional Source Beutler Lab
Gene Symbol Kctd1
Ensembl Gene ENSMUSG00000036225
Gene Name potassium channel tetramerisation domain containing 1
Synonyms 4933402K10Rik
MMRRC Submission 042749-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5169 (G1)
Quality Score 197
Status Not validated
Chromosome 18
Chromosomal Location 15101742-15284503 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15195822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 267 (E267G)
Ref Sequence ENSEMBL: ENSMUSP00000128070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025992] [ENSMUST00000168989]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025992
SMART Domains Protein: ENSMUSP00000025992
Gene: ENSMUSG00000036225

DomainStartEndE-ValueType
BTB 38 140 5e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168989
AA Change: E267G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128070
Gene: ENSMUSG00000036225
AA Change: E267G

DomainStartEndE-ValueType
low complexity region 14 44 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 70 101 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
low complexity region 217 234 N/A INTRINSIC
Pfam:DUF3504 278 435 2.6e-32 PFAM
low complexity region 482 503 N/A INTRINSIC
low complexity region 559 567 N/A INTRINSIC
BTB 634 736 5e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,841,552 (GRCm39) Y964* probably null Het
Acsbg2 T C 17: 57,156,913 (GRCm39) K375R probably benign Het
Ago4 C A 4: 126,405,520 (GRCm39) R415L probably benign Het
Alpk1 A T 3: 127,464,750 (GRCm39) I1176N probably damaging Het
Arhgap25 A T 6: 87,440,252 (GRCm39) I465N possibly damaging Het
Arhgef10 A G 8: 14,980,051 (GRCm39) D97G possibly damaging Het
Cdc37 T A 9: 21,052,413 (GRCm39) M299L probably benign Het
Ddx54 C A 5: 120,761,328 (GRCm39) H453Q probably damaging Het
Dip2b T C 15: 100,102,994 (GRCm39) Y1102H probably damaging Het
Dmpk C G 7: 18,821,944 (GRCm39) L301V probably benign Het
Dop1a T C 9: 86,415,074 (GRCm39) F1939L probably damaging Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Ints7 T C 1: 191,345,202 (GRCm39) F631L probably benign Het
Itih1 A T 14: 30,655,403 (GRCm39) Y597* probably null Het
Lrrc8e A G 8: 4,284,329 (GRCm39) T185A probably benign Het
Maco1 T C 4: 134,555,774 (GRCm39) H233R probably benign Het
Masp2 T C 4: 148,690,571 (GRCm39) I276T probably damaging Het
Med17 A T 9: 15,188,900 (GRCm39) F122I probably benign Het
Milr1 C T 11: 106,645,754 (GRCm39) R99* probably null Het
Mpp4 T C 1: 59,169,256 (GRCm39) probably null Het
Ms4a4d C T 19: 11,535,340 (GRCm39) P213S possibly damaging Het
Mtcl1 T C 17: 66,650,818 (GRCm39) N1100S probably benign Het
Myom3 T C 4: 135,502,889 (GRCm39) I322T probably benign Het
Nav2 C T 7: 49,198,231 (GRCm39) Q1287* probably null Het
Nr3c2 A T 8: 77,635,666 (GRCm39) N256Y probably damaging Het
Nrde2 A G 12: 100,095,552 (GRCm39) probably null Het
Otog G T 7: 45,947,572 (GRCm39) A2242S probably benign Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pcdh18 T C 3: 49,710,415 (GRCm39) D300G possibly damaging Het
Pcdh8 G A 14: 80,005,095 (GRCm39) P880S probably benign Het
Pcid2 A G 8: 13,129,632 (GRCm39) probably null Het
Phkb A G 8: 86,623,120 (GRCm39) H148R probably benign Het
Pik3r4 T C 9: 105,555,360 (GRCm39) S1106P probably benign Het
Pnpla7 A T 2: 24,940,321 (GRCm39) M1067L probably benign Het
Pp2d1 C A 17: 53,814,930 (GRCm39) G598V possibly damaging Het
Ppm1d C T 11: 85,223,196 (GRCm39) A267V probably damaging Het
Psg29 C T 7: 16,945,578 (GRCm39) P383S probably damaging Het
Rc3h2 A T 2: 37,295,324 (GRCm39) F231I probably damaging Het
Rpl14 T A 9: 120,401,254 (GRCm39) D32E possibly damaging Het
Rpl32 G T 6: 115,783,949 (GRCm39) N92K probably benign Het
Rragc A G 4: 123,829,457 (GRCm39) N391S probably damaging Het
Ryr3 C T 2: 112,501,005 (GRCm39) E3563K possibly damaging Het
Sh3rf2 A G 18: 42,286,126 (GRCm39) M508V probably benign Het
Shoc1 T A 4: 59,059,618 (GRCm39) Y1014F possibly damaging Het
Slc24a3 G A 2: 145,482,184 (GRCm39) C614Y probably benign Het
Spata31d1b T C 13: 59,864,309 (GRCm39) S486P probably damaging Het
Spi1 A T 2: 90,945,428 (GRCm39) K170* probably null Het
Srgn C A 10: 62,330,866 (GRCm39) D80Y probably damaging Het
St6galnac6 A G 2: 32,504,857 (GRCm39) K87R possibly damaging Het
Sytl3 A T 17: 6,982,945 (GRCm39) K134* probably null Het
Szt2 T C 4: 118,247,027 (GRCm39) T863A probably benign Het
Tcea3 A T 4: 135,992,181 (GRCm39) probably null Het
Tg T A 15: 66,550,629 (GRCm39) L253* probably null Het
Timm8a2 T A 14: 122,272,138 (GRCm39) S14T probably benign Het
Tppp3 G C 8: 106,194,501 (GRCm39) N166K probably benign Het
Trav2 G A 14: 52,804,759 (GRCm39) V4M probably benign Het
Trmt5 T C 12: 73,329,495 (GRCm39) D221G probably damaging Het
Ttc27 T A 17: 75,054,690 (GRCm39) L332* probably null Het
V1rd19 A G 7: 23,703,209 (GRCm39) N225S possibly damaging Het
Wdr20rt A T 12: 65,274,184 (GRCm39) Q448L probably damaging Het
Zc3h7b A T 15: 81,657,515 (GRCm39) N185I probably benign Het
Zmpste24 A T 4: 120,925,914 (GRCm39) I351N probably damaging Het
Other mutations in Kctd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kctd1 APN 18 15,195,747 (GRCm39) missense possibly damaging 0.51
IGL01402:Kctd1 APN 18 15,102,610 (GRCm39) missense probably damaging 0.98
IGL01404:Kctd1 APN 18 15,102,610 (GRCm39) missense probably damaging 0.98
IGL01755:Kctd1 APN 18 15,195,694 (GRCm39) missense possibly damaging 0.86
IGL02606:Kctd1 APN 18 15,195,937 (GRCm39) missense possibly damaging 0.73
IGL02725:Kctd1 APN 18 15,102,667 (GRCm39) missense possibly damaging 0.67
IGL02946:Kctd1 APN 18 15,107,036 (GRCm39) critical splice donor site probably null
R0128:Kctd1 UTSW 18 15,107,237 (GRCm39) missense probably benign 0.00
R0598:Kctd1 UTSW 18 15,140,822 (GRCm39) missense probably damaging 1.00
R1398:Kctd1 UTSW 18 15,195,654 (GRCm39) missense possibly damaging 0.85
R1669:Kctd1 UTSW 18 15,195,517 (GRCm39) missense possibly damaging 0.71
R1701:Kctd1 UTSW 18 15,102,617 (GRCm39) missense possibly damaging 0.95
R1745:Kctd1 UTSW 18 15,196,263 (GRCm39) intron probably benign
R1779:Kctd1 UTSW 18 15,194,839 (GRCm39) missense probably benign 0.01
R2083:Kctd1 UTSW 18 15,107,112 (GRCm39) missense possibly damaging 0.89
R2389:Kctd1 UTSW 18 15,195,268 (GRCm39) missense possibly damaging 0.73
R3010:Kctd1 UTSW 18 15,107,143 (GRCm39) missense probably damaging 1.00
R4576:Kctd1 UTSW 18 15,140,757 (GRCm39) missense probably damaging 1.00
R4673:Kctd1 UTSW 18 15,196,284 (GRCm39) intron probably benign
R4884:Kctd1 UTSW 18 15,107,311 (GRCm39) missense probably damaging 1.00
R4961:Kctd1 UTSW 18 15,195,580 (GRCm39) missense probably damaging 0.97
R5398:Kctd1 UTSW 18 15,195,322 (GRCm39) missense possibly damaging 0.86
R5695:Kctd1 UTSW 18 15,196,573 (GRCm39) intron probably benign
R5893:Kctd1 UTSW 18 15,102,745 (GRCm39) missense possibly damaging 0.93
R6175:Kctd1 UTSW 18 15,102,688 (GRCm39) nonsense probably null
R6767:Kctd1 UTSW 18 15,195,232 (GRCm39) missense possibly damaging 0.53
R6852:Kctd1 UTSW 18 15,119,401 (GRCm39) missense possibly damaging 0.72
R6889:Kctd1 UTSW 18 15,107,045 (GRCm39) missense probably damaging 1.00
R7189:Kctd1 UTSW 18 15,195,700 (GRCm39) missense possibly damaging 0.71
R7228:Kctd1 UTSW 18 15,195,469 (GRCm39) missense possibly damaging 0.95
R7688:Kctd1 UTSW 18 15,107,255 (GRCm39) missense probably benign 0.03
R8085:Kctd1 UTSW 18 15,140,901 (GRCm39) missense possibly damaging 0.95
R8195:Kctd1 UTSW 18 15,196,300 (GRCm39) missense unknown
R8496:Kctd1 UTSW 18 15,107,228 (GRCm39) missense probably damaging 1.00
R8924:Kctd1 UTSW 18 15,102,745 (GRCm39) missense possibly damaging 0.93
R8978:Kctd1 UTSW 18 15,119,491 (GRCm39) missense
R9094:Kctd1 UTSW 18 15,195,369 (GRCm39) missense possibly damaging 0.71
R9255:Kctd1 UTSW 18 15,194,853 (GRCm39) missense probably benign 0.00
R9629:Kctd1 UTSW 18 15,196,611 (GRCm39) missense unknown
R9680:Kctd1 UTSW 18 15,140,822 (GRCm39) missense probably damaging 1.00
Z1176:Kctd1 UTSW 18 15,196,182 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAACGAACTTGCGACCGTC -3'
(R):5'- CTTCGAGACCATGGACAAGG -3'

Sequencing Primer
(F):5'- ACCGTCCTCGTCCATGG -3'
(R):5'- TATGCCGAGGCCCGTTCTAAG -3'
Posted On 2016-07-06