Incidental Mutation 'R5170:Trp73'
ID 397492
Institutional Source Beutler Lab
Gene Symbol Trp73
Ensembl Gene ENSMUSG00000029026
Gene Name transformation related protein 73
Synonyms deltaNp73, p73, TAp73
MMRRC Submission 042750-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.478) question?
Stock # R5170 (G1)
Quality Score 193
Status Not validated
Chromosome 4
Chromosomal Location 154056253-154140208 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 154104838 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 60 (E60K)
Ref Sequence ENSEMBL: ENSMUSP00000114736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105644] [ENSMUST00000139634]
AlphaFold Q9JJP2
Predicted Effect possibly damaging
Transcript: ENSMUST00000105644
AA Change: E20K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101269
Gene: ENSMUSG00000029026
AA Change: E20K

DomainStartEndE-ValueType
Pfam:P53 112 308 3.1e-115 PFAM
Pfam:P53_tetramer 344 383 8.3e-21 PFAM
low complexity region 390 398 N/A INTRINSIC
SAM 486 552 2.71e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000139634
AA Change: E60K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114736
Gene: ENSMUSG00000029026
AA Change: E60K

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:P53 152 204 3.1e-25 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes tumor protein p73, which is a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include p53, p63, and p73 and have high sequence similarity to one another, which allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways involving direct or indirect protein interactions, resulting in regulation of the same target gene promoters or regulation of each other's promoters. The p73 protein is expressed at very low levels in normal tissues and is differentially expressed in a number of tumors. The p73 gene expresses at least 35 mRNA variants due to the use of alternate promoters, alternate translation initiation sites, and multiple splice variations. Theoretically this can account for 29 different p73 isoforms; however, the biological validity and the full-length nature of most variants have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display a variety of defects including hippocampal dysgenesis, hydrocephalus, chronic infections and inflammation, abnormal pheromone sensory pathways, eye abnormalities, impaired growth, and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,588,625 I51V probably benign Het
Agbl2 A G 2: 90,803,197 K559R probably benign Het
Arhgap30 A G 1: 171,408,050 D664G probably benign Het
BC034090 A G 1: 155,213,650 V798A probably damaging Het
Bdp1 A T 13: 100,030,794 C2237* probably null Het
C3 C T 17: 57,223,938 V388M probably damaging Het
Ccdc170 G A 10: 4,514,200 E60K probably damaging Het
Cdh8 G A 8: 99,279,550 T135M probably damaging Het
Cep131 G T 11: 120,070,609 A572E probably damaging Het
Clec16a A G 16: 10,741,791 Y976C probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Eno3 A G 11: 70,662,214 I393V probably benign Het
Fbxo47 A G 11: 97,857,694 V305A probably benign Het
Fry G A 5: 150,429,854 V1779M probably benign Het
Gm15293 A T 8: 21,201,680 D26V probably damaging Het
Gtse1 T C 15: 85,864,264 probably null Het
Gucy2e A T 11: 69,235,570 L328Q probably damaging Het
Ifi207 T C 1: 173,730,498 T225A unknown Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lamc3 A T 2: 31,887,344 M1L probably benign Het
Lman1l G A 9: 57,615,619 R153* probably null Het
Myo16 A G 8: 10,569,745 D1432G probably benign Het
Nwd2 A T 5: 63,806,037 N988I probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp14 T C 16: 35,857,279 E773G probably benign Het
Psen1 T A 12: 83,714,862 M146K probably damaging Het
Ptx4 G A 17: 25,123,178 R209Q probably benign Het
Slc13a2 T C 11: 78,400,808 T340A probably damaging Het
St8sia1 T C 6: 142,963,708 K21E probably damaging Het
Stxbp1 T C 2: 32,794,674 D581G probably benign Het
Sumo2 G A 11: 115,534,660 probably benign Het
Supt5 G A 7: 28,316,083 P910S probably benign Het
Tbc1d30 T C 10: 121,306,838 Q158R possibly damaging Het
Tenm2 T A 11: 36,024,806 H1968L probably damaging Het
Trmt1 T C 8: 84,695,232 Y220H probably damaging Het
Ttn A G 2: 76,787,069 Y8026H probably damaging Het
Zar1l A G 5: 150,517,585 probably null Het
Zfp740 T C 15: 102,209,205 Y117H probably damaging Het
Zfp941 G A 7: 140,812,957 probably benign Het
Zp1 C A 19: 10,920,554 V8F possibly damaging Het
Other mutations in Trp73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Trp73 APN 4 154081486 missense possibly damaging 0.82
IGL02264:Trp73 APN 4 154064428 missense probably null 0.98
IGL02344:Trp73 APN 4 154062043 missense possibly damaging 0.92
IGL02663:Trp73 APN 4 154062506 splice site probably null
IGL02956:Trp73 APN 4 154064463 splice site probably benign
IGL03093:Trp73 APN 4 154104873 missense probably benign 0.00
slowpoke UTSW 4 154064632 splice site probably null
R0238:Trp73 UTSW 4 154062524 unclassified probably benign
R0238:Trp73 UTSW 4 154062524 unclassified probably benign
R0363:Trp73 UTSW 4 154063949 missense probably benign 0.17
R0409:Trp73 UTSW 4 154064384 missense possibly damaging 0.81
R1161:Trp73 UTSW 4 154081323 splice site probably null
R1531:Trp73 UTSW 4 154063895 missense probably benign 0.31
R2002:Trp73 UTSW 4 154081445 missense probably damaging 1.00
R2185:Trp73 UTSW 4 154104817 critical splice donor site probably null
R3965:Trp73 UTSW 4 154062036 missense probably benign 0.03
R3966:Trp73 UTSW 4 154062036 missense probably benign 0.03
R4247:Trp73 UTSW 4 154064632 splice site probably null
R4595:Trp73 UTSW 4 154064417 missense probably damaging 0.99
R5260:Trp73 UTSW 4 154062602 missense possibly damaging 0.48
R5622:Trp73 UTSW 4 154060592 missense possibly damaging 0.68
R6173:Trp73 UTSW 4 154104341 missense probably damaging 1.00
R6252:Trp73 UTSW 4 154064397 missense probably damaging 1.00
R6950:Trp73 UTSW 4 154062053 missense probably benign 0.18
R7043:Trp73 UTSW 4 154067007 splice site probably null
R7050:Trp73 UTSW 4 154081442 missense probably damaging 1.00
R7052:Trp73 UTSW 4 154064683 missense probably damaging 0.98
R7620:Trp73 UTSW 4 154059257 nonsense probably null
R8086:Trp73 UTSW 4 154116595 missense unknown
R9034:Trp73 UTSW 4 154067631 missense probably benign 0.00
R9647:Trp73 UTSW 4 154081331 missense not run
R9671:Trp73 UTSW 4 154063946 missense not run
Z1176:Trp73 UTSW 4 154067012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCATACACATGATCTCTGTGC -3'
(R):5'- CGTGAGTGGAAGGACTTAGC -3'

Sequencing Primer
(F):5'- AGCCCTCTAGAGAACTGGC -3'
(R):5'- AGGACTTAGCACAGCTCTGG -3'
Posted On 2016-07-06