Incidental Mutation 'R5170:St8sia1'
ID397500
Institutional Source Beutler Lab
Gene Symbol St8sia1
Ensembl Gene ENSMUSG00000030283
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
SynonymsST8Sia I, Siat8, Siat8a, GD3S, GD3 synthase, 9330109E03Rik, alpha-2,8-sialyltransferase
MMRRC Submission 042750-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5170 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location142821545-142964452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142963708 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 21 (K21E)
Ref Sequence ENSEMBL: ENSMUSP00000145148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032421] [ENSMUST00000205149]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032421
AA Change: K21E

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032421
Gene: ENSMUSG00000030283
AA Change: K21E

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Pfam:Glyco_transf_29 90 344 8.1e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205149
AA Change: K21E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145148
Gene: ENSMUSG00000030283
AA Change: K21E

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
transmembrane domain 76 95 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gangliosides are membrane-bound glycosphingolipids containing sialic acid. Ganglioside GD3 is known to be important for cell adhesion and growth of cultured malignant cells. The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to GM3 to produce gangliosides GD3 and GT3. The encoded protein may be found in the Golgi apparatus and is a member of glycosyltransferase family 29. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted allele are behaviorally normal with no signs of aberrant brain histology or demyelination. Homozygotes for a knock-out allele are behaviorally intact with normal nervous tissue morphology and sensitivity to Fas-mediated apoptosis but show impaired repair of damaged nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,588,625 I51V probably benign Het
Agbl2 A G 2: 90,803,197 K559R probably benign Het
Arhgap30 A G 1: 171,408,050 D664G probably benign Het
BC034090 A G 1: 155,213,650 V798A probably damaging Het
Bdp1 A T 13: 100,030,794 C2237* probably null Het
C3 C T 17: 57,223,938 V388M probably damaging Het
Ccdc170 G A 10: 4,514,200 E60K probably damaging Het
Cdh8 G A 8: 99,279,550 T135M probably damaging Het
Cep131 G T 11: 120,070,609 A572E probably damaging Het
Clec16a A G 16: 10,741,791 Y976C probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Eno3 A G 11: 70,662,214 I393V probably benign Het
Fbxo47 A G 11: 97,857,694 V305A probably benign Het
Fry G A 5: 150,429,854 V1779M probably benign Het
Gm15293 A T 8: 21,201,680 D26V probably damaging Het
Gtse1 T C 15: 85,864,264 probably null Het
Gucy2e A T 11: 69,235,570 L328Q probably damaging Het
Ifi207 T C 1: 173,730,498 T225A unknown Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lamc3 A T 2: 31,887,344 M1L probably benign Het
Lman1l G A 9: 57,615,619 R153* probably null Het
Myo16 A G 8: 10,569,745 D1432G probably benign Het
Nwd2 A T 5: 63,806,037 N988I probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp14 T C 16: 35,857,279 E773G probably benign Het
Psen1 T A 12: 83,714,862 M146K probably damaging Het
Ptx4 G A 17: 25,123,178 R209Q probably benign Het
Slc13a2 T C 11: 78,400,808 T340A probably damaging Het
Stxbp1 T C 2: 32,794,674 D581G probably benign Het
Sumo2 G A 11: 115,534,660 probably benign Het
Supt5 G A 7: 28,316,083 P910S probably benign Het
Tbc1d30 T C 10: 121,306,838 Q158R possibly damaging Het
Tenm2 T A 11: 36,024,806 H1968L probably damaging Het
Trmt1 T C 8: 84,695,232 Y220H probably damaging Het
Trp73 C T 4: 154,104,838 E60K possibly damaging Het
Ttn A G 2: 76,787,069 Y8026H probably damaging Het
Zar1l A G 5: 150,517,585 probably null Het
Zfp740 T C 15: 102,209,205 Y117H probably damaging Het
Zfp941 G A 7: 140,812,957 probably benign Het
Zp1 C A 19: 10,920,554 V8F possibly damaging Het
Other mutations in St8sia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02081:St8sia1 APN 6 142829227 missense probably benign 0.00
IGL02138:St8sia1 APN 6 142963778 utr 5 prime probably benign
IGL02419:St8sia1 APN 6 142828935 missense probably damaging 1.00
IGL03407:St8sia1 APN 6 142914049 missense possibly damaging 0.80
PIT4453001:St8sia1 UTSW 6 142829252 nonsense probably null
PIT4498001:St8sia1 UTSW 6 142914122 missense probably damaging 1.00
R0167:St8sia1 UTSW 6 142914181 splice site probably benign
R0690:St8sia1 UTSW 6 142829254 missense probably damaging 1.00
R1727:St8sia1 UTSW 6 142876727 missense probably damaging 0.99
R1743:St8sia1 UTSW 6 142829016 missense probably damaging 1.00
R1937:St8sia1 UTSW 6 142963672 missense probably damaging 1.00
R2923:St8sia1 UTSW 6 142829237 missense probably damaging 1.00
R2983:St8sia1 UTSW 6 142963629 missense probably damaging 0.99
R3824:St8sia1 UTSW 6 142829025 missense probably damaging 1.00
R4803:St8sia1 UTSW 6 142867923 missense probably benign 0.04
R4844:St8sia1 UTSW 6 142829270 missense possibly damaging 0.82
R4865:St8sia1 UTSW 6 142829070 missense probably damaging 1.00
R4886:St8sia1 UTSW 6 142914134 missense probably damaging 0.99
R5519:St8sia1 UTSW 6 142963561 missense probably damaging 0.99
R5783:St8sia1 UTSW 6 142963614 missense possibly damaging 0.83
R6713:St8sia1 UTSW 6 142829282 splice site probably null
R7017:St8sia1 UTSW 6 142867906 missense probably damaging 0.98
R7144:St8sia1 UTSW 6 142876669 missense probably damaging 1.00
R7997:St8sia1 UTSW 6 142963650 missense probably damaging 1.00
Z1176:St8sia1 UTSW 6 142829099 missense probably damaging 1.00
Z1177:St8sia1 UTSW 6 142828810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAGAGACTGGCTGACGTC -3'
(R):5'- GATCCTTGTAGCTGACCTCTG -3'

Sequencing Primer
(F):5'- ACGTCTGGTTCGTCCTCCAAG -3'
(R):5'- TTTGCGAGCTGGAAAGCC -3'
Posted On2016-07-06