Incidental Mutation 'R5170:Dmpk'
ID397502
Institutional Source Beutler Lab
Gene Symbol Dmpk
Ensembl Gene ENSMUSG00000030409
Gene Namedystrophia myotonica-protein kinase
SynonymsDM, Dm15
MMRRC Submission 042750-MU
Accession Numbers

NCBI RefSeq: NM_032418.2, NM_001190490.1, NM_001190491.1; MGI: 94906

Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R5170 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19083849-19093821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 19088019 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 301 (L301V)
Ref Sequence ENSEMBL: ENSMUSP00000104114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000122999] [ENSMUST00000154199]
Predicted Effect probably benign
Transcript: ENSMUST00000032568
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108473
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108474
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122999
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148472
Predicted Effect probably benign
Transcript: ENSMUST00000154199
AA Change: L301V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174918
Meta Mutation Damage Score 0.0903 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype Strain: 3054407; 2182402
FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase that contains coiled-coil and C-terminal membrane association domains. In the embryonic mouse, it is found in cardiac and skeletal myocytes where it appears to play a role in myogenesis. In adults, the transcript is localized to several tissues including brain, heart, and skeletal and smooth muscle, and a function in cytoskeletal remodeling has been described. Transcripts with expanded CUG repeats in the 3' untranslated region mediate alternative splicing of several genes and sequester RNA binding proteins and RNA transcripts that contain CAG repeats, resulting in myotonic dystrophy, an autosomal dominant neuromuscular disorder. Alternative splicing results in multiple protein coding and non-coding transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null mutation exhibit abnormal sodium channel gating in cardiac myocytes, cardiac conduction defects, and late-onset progressive skeletal myopathy. Homozygotes for a second null mutation do not develop skeletal myopathy but do have abnormal muscle intracellular calcium levels. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,588,625 I51V probably benign Het
Agbl2 A G 2: 90,803,197 K559R probably benign Het
Arhgap30 A G 1: 171,408,050 D664G probably benign Het
BC034090 A G 1: 155,213,650 V798A probably damaging Het
Bdp1 A T 13: 100,030,794 C2237* probably null Het
C3 C T 17: 57,223,938 V388M probably damaging Het
Ccdc170 G A 10: 4,514,200 E60K probably damaging Het
Cdh8 G A 8: 99,279,550 T135M probably damaging Het
Cep131 G T 11: 120,070,609 A572E probably damaging Het
Clec16a A G 16: 10,741,791 Y976C probably benign Het
Eno3 A G 11: 70,662,214 I393V probably benign Het
Fbxo47 A G 11: 97,857,694 V305A probably benign Het
Fry G A 5: 150,429,854 V1779M probably benign Het
Gm15293 A T 8: 21,201,680 D26V probably damaging Het
Gtse1 T C 15: 85,864,264 probably null Het
Gucy2e A T 11: 69,235,570 L328Q probably damaging Het
Ifi207 T C 1: 173,730,498 T225A unknown Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lamc3 A T 2: 31,887,344 M1L probably benign Het
Lman1l G A 9: 57,615,619 R153* probably null Het
Myo16 A G 8: 10,569,745 D1432G probably benign Het
Nwd2 A T 5: 63,806,037 N988I probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp14 T C 16: 35,857,279 E773G probably benign Het
Psen1 T A 12: 83,714,862 M146K probably damaging Het
Ptx4 G A 17: 25,123,178 R209Q probably benign Het
Slc13a2 T C 11: 78,400,808 T340A probably damaging Het
St8sia1 T C 6: 142,963,708 K21E probably damaging Het
Stxbp1 T C 2: 32,794,674 D581G probably benign Het
Sumo2 G A 11: 115,534,660 probably benign Het
Supt5 G A 7: 28,316,083 P910S probably benign Het
Tbc1d30 T C 10: 121,306,838 Q158R possibly damaging Het
Tenm2 T A 11: 36,024,806 H1968L probably damaging Het
Trmt1 T C 8: 84,695,232 Y220H probably damaging Het
Trp73 C T 4: 154,104,838 E60K possibly damaging Het
Ttn A G 2: 76,787,069 Y8026H probably damaging Het
Zar1l A G 5: 150,517,585 probably null Het
Zfp740 T C 15: 102,209,205 Y117H probably damaging Het
Zfp941 G A 7: 140,812,957 probably benign Het
Zp1 C A 19: 10,920,554 V8F possibly damaging Het
Other mutations in Dmpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dmpk APN 7 19088192 missense probably damaging 0.98
IGL02874:Dmpk APN 7 19087001 missense possibly damaging 0.75
IGL02942:Dmpk APN 7 19092241 missense probably damaging 0.99
IGL03081:Dmpk APN 7 19087533 missense probably damaging 1.00
IGL03258:Dmpk APN 7 19092206 critical splice acceptor site probably null
IGL03302:Dmpk APN 7 19086486 splice site probably benign
P0008:Dmpk UTSW 7 19088062 missense possibly damaging 0.89
R0388:Dmpk UTSW 7 19084077 unclassified probably benign
R0961:Dmpk UTSW 7 19087270 missense probably damaging 0.99
R3103:Dmpk UTSW 7 19087654 missense probably damaging 1.00
R3157:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3158:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3159:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3498:Dmpk UTSW 7 19086381 missense probably damaging 1.00
R4696:Dmpk UTSW 7 19088214 missense probably damaging 1.00
R4830:Dmpk UTSW 7 19087528 missense probably damaging 1.00
R4991:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5156:Dmpk UTSW 7 19084125 missense probably damaging 1.00
R5169:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5171:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5172:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5198:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5200:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5202:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5205:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5383:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5449:Dmpk UTSW 7 19090991 missense probably benign 0.18
R5639:Dmpk UTSW 7 19092600 missense probably benign 0.22
R5874:Dmpk UTSW 7 19092082 intron probably benign
R6939:Dmpk UTSW 7 19088224 missense probably damaging 0.97
R7133:Dmpk UTSW 7 19087307 missense probably damaging 1.00
R7352:Dmpk UTSW 7 19086072 missense probably damaging 0.98
R8032:Dmpk UTSW 7 19088053 missense possibly damaging 0.63
R8234:Dmpk UTSW 7 19088123 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGTGGCTTGTGCTCCCAG -3'
(R):5'- ACCCTCGAAGTCTGGTGTAAAGG -3'

Sequencing Primer
(F):5'- CACTGAGTAGGTGTGCGAAGGTC -3'
(R):5'- GGGGGTACACTGTCTCGGAG -3'
Posted On2016-07-06