Incidental Mutation 'R5170:Supt5'
ID397503
Institutional Source Beutler Lab
Gene Symbol Supt5
Ensembl Gene ENSMUSG00000003435
Gene Namesuppressor of Ty 5
SynonymsSupt5h, Spt5
MMRRC Submission 042750-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5170 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28314891-28338746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28316083 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 910 (P910S)
Ref Sequence ENSEMBL: ENSMUSP00000147164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003527] [ENSMUST00000081946] [ENSMUST00000207563] [ENSMUST00000209141]
Predicted Effect probably benign
Transcript: ENSMUST00000003527
AA Change: P910S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000003527
Gene: ENSMUSG00000003435
AA Change: P910S

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
coiled coil region 36 63 N/A INTRINSIC
Pfam:Spt5_N 73 170 8.1e-17 PFAM
NGN 174 265 2.2e-14 SMART
KOW 270 297 8.77e0 SMART
KOW 417 444 8.69e-4 SMART
KOW 469 496 9.1e-7 SMART
KOW 591 618 2.46e-3 SMART
low complexity region 677 695 N/A INTRINSIC
KOW 697 724 3.93e-2 SMART
CTD 766 902 2.09e-31 SMART
KOW 1028 1055 9.69e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081946
SMART Domains Protein: ENSMUSP00000080614
Gene: ENSMUSG00000003438

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
CPDc 146 274 1.33e-41 SMART
low complexity region 313 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136427
Predicted Effect probably benign
Transcript: ENSMUST00000207563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209105
Predicted Effect probably benign
Transcript: ENSMUST00000209141
AA Change: P910S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,588,625 I51V probably benign Het
Agbl2 A G 2: 90,803,197 K559R probably benign Het
Arhgap30 A G 1: 171,408,050 D664G probably benign Het
BC034090 A G 1: 155,213,650 V798A probably damaging Het
Bdp1 A T 13: 100,030,794 C2237* probably null Het
C3 C T 17: 57,223,938 V388M probably damaging Het
Ccdc170 G A 10: 4,514,200 E60K probably damaging Het
Cdh8 G A 8: 99,279,550 T135M probably damaging Het
Cep131 G T 11: 120,070,609 A572E probably damaging Het
Clec16a A G 16: 10,741,791 Y976C probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Eno3 A G 11: 70,662,214 I393V probably benign Het
Fbxo47 A G 11: 97,857,694 V305A probably benign Het
Fry G A 5: 150,429,854 V1779M probably benign Het
Gm15293 A T 8: 21,201,680 D26V probably damaging Het
Gtse1 T C 15: 85,864,264 probably null Het
Gucy2e A T 11: 69,235,570 L328Q probably damaging Het
Ifi207 T C 1: 173,730,498 T225A unknown Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lamc3 A T 2: 31,887,344 M1L probably benign Het
Lman1l G A 9: 57,615,619 R153* probably null Het
Myo16 A G 8: 10,569,745 D1432G probably benign Het
Nwd2 A T 5: 63,806,037 N988I probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp14 T C 16: 35,857,279 E773G probably benign Het
Psen1 T A 12: 83,714,862 M146K probably damaging Het
Ptx4 G A 17: 25,123,178 R209Q probably benign Het
Slc13a2 T C 11: 78,400,808 T340A probably damaging Het
St8sia1 T C 6: 142,963,708 K21E probably damaging Het
Stxbp1 T C 2: 32,794,674 D581G probably benign Het
Sumo2 G A 11: 115,534,660 probably benign Het
Tbc1d30 T C 10: 121,306,838 Q158R possibly damaging Het
Tenm2 T A 11: 36,024,806 H1968L probably damaging Het
Trmt1 T C 8: 84,695,232 Y220H probably damaging Het
Trp73 C T 4: 154,104,838 E60K possibly damaging Het
Ttn A G 2: 76,787,069 Y8026H probably damaging Het
Zar1l A G 5: 150,517,585 probably null Het
Zfp740 T C 15: 102,209,205 Y117H probably damaging Het
Zfp941 G A 7: 140,812,957 probably benign Het
Zp1 C A 19: 10,920,554 V8F possibly damaging Het
Other mutations in Supt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Supt5 APN 7 28315382 missense probably benign 0.08
IGL01077:Supt5 APN 7 28323788 nonsense probably null
IGL01477:Supt5 APN 7 28317264 missense possibly damaging 0.94
IGL01813:Supt5 APN 7 28323975 missense probably damaging 0.99
IGL02405:Supt5 APN 7 28315824 missense probably benign 0.00
IGL02525:Supt5 APN 7 28318947 splice site probably benign
IGL02584:Supt5 APN 7 28326167 missense probably benign 0.08
IGL03387:Supt5 APN 7 28320083 missense possibly damaging 0.89
R0420:Supt5 UTSW 7 28317329 splice site probably benign
R0715:Supt5 UTSW 7 28329037 missense probably damaging 1.00
R1226:Supt5 UTSW 7 28328747 missense probably benign 0.03
R1655:Supt5 UTSW 7 28330024 missense probably benign 0.00
R1801:Supt5 UTSW 7 28317214 critical splice donor site probably null
R2424:Supt5 UTSW 7 28315165 missense possibly damaging 0.47
R2883:Supt5 UTSW 7 28329320 missense possibly damaging 0.75
R4280:Supt5 UTSW 7 28317073 missense probably damaging 1.00
R4614:Supt5 UTSW 7 28325972 missense possibly damaging 0.65
R4792:Supt5 UTSW 7 28316329 missense probably benign 0.19
R4997:Supt5 UTSW 7 28316037 missense probably benign 0.05
R5041:Supt5 UTSW 7 28315380 missense probably damaging 1.00
R5062:Supt5 UTSW 7 28329015 splice site probably null
R5119:Supt5 UTSW 7 28316370 missense probably damaging 1.00
R5687:Supt5 UTSW 7 28317763 missense probably benign 0.27
R5720:Supt5 UTSW 7 28322568 missense probably damaging 0.97
R5935:Supt5 UTSW 7 28329475 missense probably benign 0.09
R6032:Supt5 UTSW 7 28316175 missense probably damaging 1.00
R6032:Supt5 UTSW 7 28316175 missense probably damaging 1.00
R6049:Supt5 UTSW 7 28315197 missense probably benign 0.32
R7043:Supt5 UTSW 7 28320010 missense probably benign 0.00
R7085:Supt5 UTSW 7 28331489 missense unknown
R7152:Supt5 UTSW 7 28323900 missense probably benign 0.00
R7201:Supt5 UTSW 7 28316788 missense probably benign 0.03
R7401:Supt5 UTSW 7 28323772 missense probably damaging 0.99
R7959:Supt5 UTSW 7 28315799 missense probably benign 0.43
R8181:Supt5 UTSW 7 28331474 missense unknown
Z1177:Supt5 UTSW 7 28317031 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTAACCTCCAGGAGAAGGTGC -3'
(R):5'- CAGCCATGTGAGTCCATCAG -3'

Sequencing Primer
(F):5'- GGTCATTGGACTGTAGCCAAC -3'
(R):5'- TGAGCCCGAAAAGCCCTG -3'
Posted On2016-07-06