Mutagenetix > Incidental Mutation

Incidental Mutation 'R5170:Supt5'

397503

Institutional Source

Beutler Lab

Gene Symbol

Supt5

Ensembl Gene

ENSMUSG00000003435

Gene Name

suppressor of Ty 5

Synonyms

Supt5h, Spt5

MMRRC Submission

042750-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5170 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

28314891-28338746 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 28316083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 910 (P910S)

Ref Sequence

ENSEMBL: ENSMUSP00000147164 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003527] [ENSMUST00000081946] [ENSMUST00000207563] [ENSMUST00000209141]

AlphaFold

O55201

Predicted Effect

probably benign
Transcript: ENSMUST00000003527
AA Change: P910S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000003527
Gene: ENSMUSG00000003435
AA Change: P910S

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
coiled coil region	36	63	N/A	INTRINSIC
Pfam:Spt5_N	73	170	8.1e-17	PFAM
NGN	174	265	2.2e-14	SMART
KOW	270	297	8.77e0	SMART
KOW	417	444	8.69e-4	SMART
KOW	469	496	9.1e-7	SMART
KOW	591	618	2.46e-3	SMART
low complexity region	677	695	N/A	INTRINSIC
KOW	697	724	3.93e-2	SMART
CTD	766	902	2.09e-31	SMART
KOW	1028	1055	9.69e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000081946

SMART Domains

Protein: ENSMUSP00000080614
Gene: ENSMUSG00000003438

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
transmembrane domain	66	88	N/A	INTRINSIC
CPDc	146	274	1.33e-41	SMART
low complexity region	313	330	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131849

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135220

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136427

Predicted Effect

probably benign
Transcript: ENSMUST00000207563

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207649

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207879

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209105

Predicted Effect

probably benign
Transcript: ENSMUST00000209141
AA Change: P910S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	A	G	5: 35,588,625	I51V	probably benign	Het
Agbl2	A	G	2: 90,803,197	K559R	probably benign	Het
Arhgap30	A	G	1: 171,408,050	D664G	probably benign	Het
BC034090	A	G	1: 155,213,650	V798A	probably damaging	Het
Bdp1	A	T	13: 100,030,794	C2237*	probably null	Het
C3	C	T	17: 57,223,938	V388M	probably damaging	Het
Ccdc170	G	A	10: 4,514,200	E60K	probably damaging	Het
Cdh8	G	A	8: 99,279,550	T135M	probably damaging	Het
Cep131	G	T	11: 120,070,609	A572E	probably damaging	Het
Clec16a	A	G	16: 10,741,791	Y976C	probably benign	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
Eno3	A	G	11: 70,662,214	I393V	probably benign	Het
Fbxo47	A	G	11: 97,857,694	V305A	probably benign	Het
Fry	G	A	5: 150,429,854	V1779M	probably benign	Het
Gm15293	A	T	8: 21,201,680	D26V	probably damaging	Het
Gtse1	T	C	15: 85,864,264		probably null	Het
Gucy2e	A	T	11: 69,235,570	L328Q	probably damaging	Het
Ifi207	T	C	1: 173,730,498	T225A	unknown	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Lamc3	A	T	2: 31,887,344	M1L	probably benign	Het
Lman1l	G	A	9: 57,615,619	R153*	probably null	Het
Myo16	A	G	8: 10,569,745	D1432G	probably benign	Het
Nwd2	A	T	5: 63,806,037	N988I	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Parp14	T	C	16: 35,857,279	E773G	probably benign	Het
Psen1	T	A	12: 83,714,862	M146K	probably damaging	Het
Ptx4	G	A	17: 25,123,178	R209Q	probably benign	Het
Slc13a2	T	C	11: 78,400,808	T340A	probably damaging	Het
St8sia1	T	C	6: 142,963,708	K21E	probably damaging	Het
Stxbp1	T	C	2: 32,794,674	D581G	probably benign	Het
Sumo2	G	A	11: 115,534,660		probably benign	Het
Tbc1d30	T	C	10: 121,306,838	Q158R	possibly damaging	Het
Tenm2	T	A	11: 36,024,806	H1968L	probably damaging	Het
Trmt1	T	C	8: 84,695,232	Y220H	probably damaging	Het
Trp73	C	T	4: 154,104,838	E60K	possibly damaging	Het
Ttn	A	G	2: 76,787,069	Y8026H	probably damaging	Het
Zar1l	A	G	5: 150,517,585		probably null	Het
Zfp740	T	C	15: 102,209,205	Y117H	probably damaging	Het
Zfp941	G	A	7: 140,812,957		probably benign	Het
Zp1	C	A	19: 10,920,554	V8F	possibly damaging	Het

Other mutations in Supt5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Supt5	APN	7	28315382	missense	probably benign	0.08
IGL01077:Supt5	APN	7	28323788	nonsense	probably null
IGL01477:Supt5	APN	7	28317264	missense	possibly damaging	0.94
IGL01813:Supt5	APN	7	28323975	missense	probably damaging	0.99
IGL02405:Supt5	APN	7	28315824	missense	probably benign	0.00
IGL02525:Supt5	APN	7	28318947	splice site	probably benign
IGL02584:Supt5	APN	7	28326167	missense	probably benign	0.08
IGL03387:Supt5	APN	7	28320083	missense	possibly damaging	0.89
R0420:Supt5	UTSW	7	28317329	splice site	probably benign
R0715:Supt5	UTSW	7	28329037	missense	probably damaging	1.00
R1226:Supt5	UTSW	7	28328747	missense	probably benign	0.03
R1655:Supt5	UTSW	7	28330024	missense	probably benign	0.00
R1801:Supt5	UTSW	7	28317214	critical splice donor site	probably null
R2424:Supt5	UTSW	7	28315165	missense	possibly damaging	0.47
R2883:Supt5	UTSW	7	28329320	missense	possibly damaging	0.75
R4280:Supt5	UTSW	7	28317073	missense	probably damaging	1.00
R4614:Supt5	UTSW	7	28325972	missense	possibly damaging	0.65
R4792:Supt5	UTSW	7	28316329	missense	probably benign	0.19
R4997:Supt5	UTSW	7	28316037	missense	probably benign	0.05
R5041:Supt5	UTSW	7	28315380	missense	probably damaging	1.00
R5062:Supt5	UTSW	7	28329015	splice site	probably null
R5119:Supt5	UTSW	7	28316370	missense	probably damaging	1.00
R5687:Supt5	UTSW	7	28317763	missense	probably benign	0.27
R5720:Supt5	UTSW	7	28322568	missense	probably damaging	0.97
R5935:Supt5	UTSW	7	28329475	missense	probably benign	0.09
R6032:Supt5	UTSW	7	28316175	missense	probably damaging	1.00
R6032:Supt5	UTSW	7	28316175	missense	probably damaging	1.00
R6049:Supt5	UTSW	7	28315197	missense	probably benign	0.32
R7043:Supt5	UTSW	7	28320010	missense	probably benign	0.00
R7085:Supt5	UTSW	7	28331489	missense	unknown
R7152:Supt5	UTSW	7	28323900	missense	probably benign	0.00
R7201:Supt5	UTSW	7	28316788	missense	probably benign	0.03
R7401:Supt5	UTSW	7	28323772	missense	probably damaging	0.99
R7959:Supt5	UTSW	7	28315799	missense	probably benign	0.43
R8181:Supt5	UTSW	7	28331474	missense	unknown
R8998:Supt5	UTSW	7	28338423	missense	unknown
R8999:Supt5	UTSW	7	28338423	missense	unknown
R9021:Supt5	UTSW	7	28317246	missense	probably damaging	0.98
R9314:Supt5	UTSW	7	28320374	missense	probably damaging	0.99
R9345:Supt5	UTSW	7	28316987	missense	probably benign	0.03
R9477:Supt5	UTSW	7	28326075	missense	probably damaging	0.99
R9568:Supt5	UTSW	7	28315263	missense	not run
Z1177:Supt5	UTSW	7	28317031	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TGTAACCTCCAGGAGAAGGTGC -3'
(R):5'- CAGCCATGTGAGTCCATCAG -3'

Sequencing Primer
(F):5'- GGTCATTGGACTGTAGCCAAC -3'
(R):5'- TGAGCCCGAAAAGCCCTG -3'

Posted On

2016-07-06