Mutagenetix > Incidental Mutations

Incidental Mutation 'R5170:Gucy2e'

397515

Institutional Source

Beutler Lab

Gene Symbol

Gucy2e

Ensembl Gene

ENSMUSG00000020890

Gene Name

guanylate cyclase 2e

Synonyms

GC1, GC-E, ROS-GC1

MMRRC Submission

042750-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.322) question?

Stock #

R5170 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69218117-69237036 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69235570 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 328 (L328Q)

Ref Sequence

ENSEMBL: ENSMUSP00000104305 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021259] [ENSMUST00000108664] [ENSMUST00000108665]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021259
AA Change: L328Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000021259
Gene: ENSMUSG00000020890
AA Change: L328Q

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	5.3e-37	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	557	807	1.1e-24	PFAM
Pfam:Pkinase_Tyr	560	807	2e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108664
AA Change: L328Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000104304
Gene: ENSMUSG00000020890
AA Change: L328Q

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	2.4e-40	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	560	807	9.5e-23	PFAM
Pfam:Pkinase_Tyr	560	807	7.7e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108665
AA Change: L328Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000104305
Gene: ENSMUSG00000020890
AA Change: L328Q

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	5.3e-37	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	557	807	1.1e-24	PFAM
Pfam:Pkinase_Tyr	560	807	2e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155457

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retina-specific guanylate cyclase, which is a member of the membrane guanylyl cyclase family. Like other membrane guanylyl cyclases, this enzyme has a hydrophobic amino-terminal signal sequence followed by a large extracellular domain, a single membrane spanning domain, a kinase homology domain, and a guanylyl cyclase catalytic domain. In contrast to other membrane guanylyl cyclases, this enzyme is not activated by natriuretic peptides. Mutations in this gene result in Leber congenital amaurosis and cone-rod dystrophy-6 diseases. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retinal cone cell morphology, impaired cone and rod electrophysiology, and severe retinal cone cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	A	G	5: 35,588,625	I51V	probably benign	Het
Agbl2	A	G	2: 90,803,197	K559R	probably benign	Het
Arhgap30	A	G	1: 171,408,050	D664G	probably benign	Het
BC034090	A	G	1: 155,213,650	V798A	probably damaging	Het
Bdp1	A	T	13: 100,030,794	C2237*	probably null	Het
C3	C	T	17: 57,223,938	V388M	probably damaging	Het
Ccdc170	G	A	10: 4,514,200	E60K	probably damaging	Het
Cdh8	G	A	8: 99,279,550	T135M	probably damaging	Het
Cep131	G	T	11: 120,070,609	A572E	probably damaging	Het
Clec16a	A	G	16: 10,741,791	Y976C	probably benign	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
Eno3	A	G	11: 70,662,214	I393V	probably benign	Het
Fbxo47	A	G	11: 97,857,694	V305A	probably benign	Het
Fry	G	A	5: 150,429,854	V1779M	probably benign	Het
Gm15293	A	T	8: 21,201,680	D26V	probably damaging	Het
Gtse1	T	C	15: 85,864,264		probably null	Het
Ifi207	T	C	1: 173,730,498	T225A	unknown	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Lamc3	A	T	2: 31,887,344	M1L	probably benign	Het
Lman1l	G	A	9: 57,615,619	R153*	probably null	Het
Myo16	A	G	8: 10,569,745	D1432G	probably benign	Het
Nwd2	A	T	5: 63,806,037	N988I	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Parp14	T	C	16: 35,857,279	E773G	probably benign	Het
Psen1	T	A	12: 83,714,862	M146K	probably damaging	Het
Ptx4	G	A	17: 25,123,178	R209Q	probably benign	Het
Slc13a2	T	C	11: 78,400,808	T340A	probably damaging	Het
St8sia1	T	C	6: 142,963,708	K21E	probably damaging	Het
Stxbp1	T	C	2: 32,794,674	D581G	probably benign	Het
Sumo2	G	A	11: 115,534,660		probably benign	Het
Supt5	G	A	7: 28,316,083	P910S	probably benign	Het
Tbc1d30	T	C	10: 121,306,838	Q158R	possibly damaging	Het
Tenm2	T	A	11: 36,024,806	H1968L	probably damaging	Het
Trmt1	T	C	8: 84,695,232	Y220H	probably damaging	Het
Trp73	C	T	4: 154,104,838	E60K	possibly damaging	Het
Ttn	A	G	2: 76,787,069	Y8026H	probably damaging	Het
Zar1l	A	G	5: 150,517,585		probably null	Het
Zfp740	T	C	15: 102,209,205	Y117H	probably damaging	Het
Zfp941	G	A	7: 140,812,957		probably benign	Het
Zp1	C	A	19: 10,920,554	V8F	possibly damaging	Het

Other mutations in Gucy2e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00916:Gucy2e	APN	11	69223097	missense	possibly damaging	0.88
IGL01626:Gucy2e	APN	11	69232855	missense	possibly damaging	0.80
IGL01756:Gucy2e	APN	11	69232852	missense	probably damaging	0.98
IGL02030:Gucy2e	APN	11	69223816	missense	probably damaging	1.00
IGL02095:Gucy2e	APN	11	69232787	missense	possibly damaging	0.48
IGL02387:Gucy2e	APN	11	69236116	missense	probably benign
IGL02622:Gucy2e	APN	11	69225031	missense	probably damaging	1.00
IGL02660:Gucy2e	APN	11	69232007	missense	probably benign	0.18
IGL03181:Gucy2e	APN	11	69230182	splice site	probably benign
R0110:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R0115:Gucy2e	UTSW	11	69236632	missense	unknown
R0450:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R0469:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R0497:Gucy2e	UTSW	11	69224159	missense	probably damaging	1.00
R0510:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R1252:Gucy2e	UTSW	11	69235659	missense	probably benign
R1535:Gucy2e	UTSW	11	69226244	missense	probably damaging	1.00
R1700:Gucy2e	UTSW	11	69232058	missense	probably benign
R2035:Gucy2e	UTSW	11	69227532	missense	probably benign	0.12
R2179:Gucy2e	UTSW	11	69228578	splice site	probably null
R3622:Gucy2e	UTSW	11	69225051	missense	probably damaging	1.00
R4212:Gucy2e	UTSW	11	69228123	missense	probably damaging	0.99
R4600:Gucy2e	UTSW	11	69236168	missense	possibly damaging	0.71
R4790:Gucy2e	UTSW	11	69228448	missense	probably damaging	1.00
R5174:Gucy2e	UTSW	11	69236566	missense	probably benign
R5440:Gucy2e	UTSW	11	69223646	missense	probably damaging	0.98
R5586:Gucy2e	UTSW	11	69226256	missense	probably damaging	1.00
R5668:Gucy2e	UTSW	11	69228381	missense	probably damaging	1.00
R5820:Gucy2e	UTSW	11	69232696	missense	probably benign	0.36
R5826:Gucy2e	UTSW	11	69236033	missense	possibly damaging	0.53
R6169:Gucy2e	UTSW	11	69236104	missense	probably benign	0.19
R6544:Gucy2e	UTSW	11	69235657	missense	probably benign
R6815:Gucy2e	UTSW	11	69232001	missense	possibly damaging	0.86
R7020:Gucy2e	UTSW	11	69232793	missense	probably benign	0.00
R7592:Gucy2e	UTSW	11	69223324	critical splice donor site	probably null
R7658:Gucy2e	UTSW	11	69226229	nonsense	probably null
R7812:Gucy2e	UTSW	11	69226243	missense	probably damaging	1.00
R8284:Gucy2e	UTSW	11	69232351	missense	probably benign
X0025:Gucy2e	UTSW	11	69226244	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTTACGCCCCATTGACTC -3'
(R):5'- AAGAACTGGCTCTGACTGATGG -3'

Sequencing Primer
(F):5'- GCCCCATTGACTCCACCC -3'
(R):5'- TCTGACTGATGGCTCCCTGG -3'

Posted On

2016-07-06