Mutagenetix > Incidental Mutations

Incidental Mutation 'R5170:Slc13a2'

397516

Institutional Source

Beutler Lab

Gene Symbol

Slc13a2

Ensembl Gene

ENSMUSG00000001095

Gene Name

solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2

Synonyms

sodium/dicarboxylate co-transporter, Nadc1, mNaDC-1

MMRRC Submission

042750-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5170 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78397087-78422217 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78400808 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 340 (T340A)

Ref Sequence

ENSEMBL: ENSMUSP00000001122 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001122]

Predicted Effect

probably damaging
Transcript: ENSMUST00000001122
AA Change: T340A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000001122
Gene: ENSMUSG00000001095
AA Change: T340A

Domain	Start	End	E-Value	Type
Pfam:Na_sulph_symp	6	560	7.1e-161	PFAM
Pfam:CitMHS	45	164	3e-15	PFAM
Pfam:CitMHS	203	499	1.5e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149865

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-coupled citrate transporter that is regulated by the chaperone activity of cyclophilin b. The encoded protein may play a role in the formation of kidney stones. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased Kreb cycle intermediates in the urine but otherwise have normal kidney function and response to ischemia-reperfusion injury and caloric restriction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	A	G	5: 35,588,625	I51V	probably benign	Het
Agbl2	A	G	2: 90,803,197	K559R	probably benign	Het
Arhgap30	A	G	1: 171,408,050	D664G	probably benign	Het
BC034090	A	G	1: 155,213,650	V798A	probably damaging	Het
Bdp1	A	T	13: 100,030,794	C2237*	probably null	Het
C3	C	T	17: 57,223,938	V388M	probably damaging	Het
Ccdc170	G	A	10: 4,514,200	E60K	probably damaging	Het
Cdh8	G	A	8: 99,279,550	T135M	probably damaging	Het
Cep131	G	T	11: 120,070,609	A572E	probably damaging	Het
Clec16a	A	G	16: 10,741,791	Y976C	probably benign	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
Eno3	A	G	11: 70,662,214	I393V	probably benign	Het
Fbxo47	A	G	11: 97,857,694	V305A	probably benign	Het
Fry	G	A	5: 150,429,854	V1779M	probably benign	Het
Gm15293	A	T	8: 21,201,680	D26V	probably damaging	Het
Gtse1	T	C	15: 85,864,264		probably null	Het
Gucy2e	A	T	11: 69,235,570	L328Q	probably damaging	Het
Ifi207	T	C	1: 173,730,498	T225A	unknown	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Lamc3	A	T	2: 31,887,344	M1L	probably benign	Het
Lman1l	G	A	9: 57,615,619	R153*	probably null	Het
Myo16	A	G	8: 10,569,745	D1432G	probably benign	Het
Nwd2	A	T	5: 63,806,037	N988I	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Parp14	T	C	16: 35,857,279	E773G	probably benign	Het
Psen1	T	A	12: 83,714,862	M146K	probably damaging	Het
Ptx4	G	A	17: 25,123,178	R209Q	probably benign	Het
St8sia1	T	C	6: 142,963,708	K21E	probably damaging	Het
Stxbp1	T	C	2: 32,794,674	D581G	probably benign	Het
Sumo2	G	A	11: 115,534,660		probably benign	Het
Supt5	G	A	7: 28,316,083	P910S	probably benign	Het
Tbc1d30	T	C	10: 121,306,838	Q158R	possibly damaging	Het
Tenm2	T	A	11: 36,024,806	H1968L	probably damaging	Het
Trmt1	T	C	8: 84,695,232	Y220H	probably damaging	Het
Trp73	C	T	4: 154,104,838	E60K	possibly damaging	Het
Ttn	A	G	2: 76,787,069	Y8026H	probably damaging	Het
Zar1l	A	G	5: 150,517,585		probably null	Het
Zfp740	T	C	15: 102,209,205	Y117H	probably damaging	Het
Zfp941	G	A	7: 140,812,957		probably benign	Het
Zp1	C	A	19: 10,920,554	V8F	possibly damaging	Het

Other mutations in Slc13a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Slc13a2	APN	11	78400548	missense	probably damaging	1.00
IGL01604:Slc13a2	APN	11	78403395	missense	possibly damaging	0.82
IGL01679:Slc13a2	APN	11	78404711	missense	probably damaging	1.00
IGL03100:Slc13a2	APN	11	78404473	missense	probably damaging	1.00
IGL03380:Slc13a2	APN	11	78399082	missense	probably benign	0.03
deliberate	UTSW	11	78403480	critical splice acceptor site	probably benign
Familiaris	UTSW	11	78404795	missense	probably damaging	1.00
intentional	UTSW	11	78404708	missense	probably damaging	1.00
R0085:Slc13a2	UTSW	11	78406868	missense	probably damaging	0.96
R0324:Slc13a2	UTSW	11	78404524	missense	probably damaging	1.00
R0368:Slc13a2	UTSW	11	78404800	nonsense	probably null
R0440:Slc13a2	UTSW	11	78403175	missense	probably benign	0.05
R0539:Slc13a2	UTSW	11	78399138	missense	probably damaging	1.00
R1519:Slc13a2	UTSW	11	78397746	missense	possibly damaging	0.59
R1550:Slc13a2	UTSW	11	78403164	missense	probably damaging	1.00
R1909:Slc13a2	UTSW	11	78400142	missense	possibly damaging	0.90
R2166:Slc13a2	UTSW	11	78403075	missense	probably benign	0.16
R2994:Slc13a2	UTSW	11	78404737	missense	probably damaging	1.00
R2998:Slc13a2	UTSW	11	78404785	missense	probably damaging	0.99
R3418:Slc13a2	UTSW	11	78400840	missense	probably benign	0.05
R3932:Slc13a2	UTSW	11	78398400	missense	probably damaging	1.00
R4233:Slc13a2	UTSW	11	78403535	intron	probably benign
R4462:Slc13a2	UTSW	11	78404387	missense	probably benign	0.44
R5014:Slc13a2	UTSW	11	78400161	missense	possibly damaging	0.73
R5484:Slc13a2	UTSW	11	78404822	splice site	probably benign
R5809:Slc13a2	UTSW	11	78397821	missense	probably damaging	1.00
R5973:Slc13a2	UTSW	11	78400532	missense	probably damaging	0.99
R6243:Slc13a2	UTSW	11	78404708	missense	probably damaging	1.00
R6263:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6275:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6276:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6279:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6280:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6300:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6305:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6314:Slc13a2	UTSW	11	78403480	critical splice acceptor site	probably benign
R6673:Slc13a2	UTSW	11	78397831	missense	probably benign	0.12
R7138:Slc13a2	UTSW	11	78399124	missense	possibly damaging	0.76
R7382:Slc13a2	UTSW	11	78404795	missense	probably damaging	1.00
R7657:Slc13a2	UTSW	11	78398397	missense	probably damaging	0.99
R7791:Slc13a2	UTSW	11	78422064	critical splice donor site	probably null
R8027:Slc13a2	UTSW	11	78404756	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCCATCTGATACCATGCTGTG -3'
(R):5'- AGAGCCTTTATACACTGTCCCTG -3'

Sequencing Primer
(F):5'- ACAGAGAAGGGTCCCTCC -3'
(R):5'- ATACACTGTCCCTGCCTCTG -3'

Posted On

2016-07-06