Incidental Mutation 'R5170:Sumo2'
ID397519
Institutional Source Beutler Lab
Gene Symbol Sumo2
Ensembl Gene ENSMUSG00000020738
Gene Namesmall ubiquitin-like modifier 2
SynonymsSmt3h2, Smt3b
MMRRC Submission 042750-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5170 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115523102-115536276 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 115534660 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021084] [ENSMUST00000117589] [ENSMUST00000118155] [ENSMUST00000121185] [ENSMUST00000153892]
Predicted Effect silent
Transcript: ENSMUST00000021084
SMART Domains Protein: ENSMUSP00000021084
Gene: ENSMUSG00000020738

DomainStartEndE-ValueType
Pfam:Rad60-SLD 18 52 1.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050672
Predicted Effect probably benign
Transcript: ENSMUST00000117589
SMART Domains Protein: ENSMUSP00000113883
Gene: ENSMUSG00000020738

DomainStartEndE-ValueType
Pfam:Rad60-SLD 1 45 1.1e-17 PFAM
Pfam:ubiquitin 1 48 1.8e-10 PFAM
Predicted Effect silent
Transcript: ENSMUST00000118155
SMART Domains Protein: ENSMUSP00000113108
Gene: ENSMUSG00000020738

DomainStartEndE-ValueType
Pfam:Rad60-SLD 18 52 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121185
SMART Domains Protein: ENSMUSP00000112594
Gene: ENSMUSG00000020738

DomainStartEndE-ValueType
Pfam:Rad60-SLD 1 45 1.1e-17 PFAM
Pfam:ubiquitin 1 48 1.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140844
Predicted Effect silent
Transcript: ENSMUST00000153892
SMART Domains Protein: ENSMUSP00000115044
Gene: ENSMUSG00000020738

DomainStartEndE-ValueType
UBQ 18 89 1.07e-13 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display severe embryonic growth retardation and die at approximately embryonic day E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,588,625 I51V probably benign Het
Agbl2 A G 2: 90,803,197 K559R probably benign Het
Arhgap30 A G 1: 171,408,050 D664G probably benign Het
BC034090 A G 1: 155,213,650 V798A probably damaging Het
Bdp1 A T 13: 100,030,794 C2237* probably null Het
C3 C T 17: 57,223,938 V388M probably damaging Het
Ccdc170 G A 10: 4,514,200 E60K probably damaging Het
Cdh8 G A 8: 99,279,550 T135M probably damaging Het
Cep131 G T 11: 120,070,609 A572E probably damaging Het
Clec16a A G 16: 10,741,791 Y976C probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Eno3 A G 11: 70,662,214 I393V probably benign Het
Fbxo47 A G 11: 97,857,694 V305A probably benign Het
Fry G A 5: 150,429,854 V1779M probably benign Het
Gm15293 A T 8: 21,201,680 D26V probably damaging Het
Gtse1 T C 15: 85,864,264 probably null Het
Gucy2e A T 11: 69,235,570 L328Q probably damaging Het
Ifi207 T C 1: 173,730,498 T225A unknown Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lamc3 A T 2: 31,887,344 M1L probably benign Het
Lman1l G A 9: 57,615,619 R153* probably null Het
Myo16 A G 8: 10,569,745 D1432G probably benign Het
Nwd2 A T 5: 63,806,037 N988I probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp14 T C 16: 35,857,279 E773G probably benign Het
Psen1 T A 12: 83,714,862 M146K probably damaging Het
Ptx4 G A 17: 25,123,178 R209Q probably benign Het
Slc13a2 T C 11: 78,400,808 T340A probably damaging Het
St8sia1 T C 6: 142,963,708 K21E probably damaging Het
Stxbp1 T C 2: 32,794,674 D581G probably benign Het
Supt5 G A 7: 28,316,083 P910S probably benign Het
Tbc1d30 T C 10: 121,306,838 Q158R possibly damaging Het
Tenm2 T A 11: 36,024,806 H1968L probably damaging Het
Trmt1 T C 8: 84,695,232 Y220H probably damaging Het
Trp73 C T 4: 154,104,838 E60K possibly damaging Het
Ttn A G 2: 76,787,069 Y8026H probably damaging Het
Zar1l A G 5: 150,517,585 probably null Het
Zfp740 T C 15: 102,209,205 Y117H probably damaging Het
Zfp941 G A 7: 140,812,957 probably benign Het
Zp1 C A 19: 10,920,554 V8F possibly damaging Het
Other mutations in Sumo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6786:Sumo2 UTSW 11 115523775 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGTCATGCAATACTGTGATGGTAC -3'
(R):5'- ACTTGTAACACTTTGTGCAGGG -3'

Sequencing Primer
(F):5'- GGTACATTTTCTACTCCTAATTCGG -3'
(R):5'- AGGGTTTCTGATCTTTCAGCCCAG -3'
Posted On2016-07-06