Incidental Mutation 'R5170:Psen1'
ID397520
Institutional Source Beutler Lab
Gene Symbol Psen1
Ensembl Gene ENSMUSG00000019969
Gene Namepresenilin 1
SynonymsPS1, PS-1, S182, presenilin-1, Ad3h
MMRRC Submission 042750-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5170 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location83688152-83735199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83714862 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 146 (M146K)
Ref Sequence ENSEMBL: ENSMUSP00000098786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041806] [ENSMUST00000101225]
Predicted Effect probably damaging
Transcript: ENSMUST00000041806
AA Change: M146K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048363
Gene: ENSMUSG00000019969
AA Change: M146K

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Blast:PSN 75 113 1e-12 BLAST
PSN 130 453 2.03e-150 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101225
AA Change: M146K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098786
Gene: ENSMUSG00000019969
AA Change: M146K

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Blast:PSN 75 113 1e-12 BLAST
PSN 130 453 2.03e-150 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223542
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alzheimer's disease (AD) patients with an inherited form of the disease carry mutations in the presenilin proteins (PSEN1; PSEN2) or in the amyloid precursor protein (APP). These disease-linked mutations result in increased production of the longer form of amyloid-beta (main component of amyloid deposits found in AD brains). Presenilins are postulated to regulate APP processing through their effects on gamma-secretase, an enzyme that cleaves APP. Also, it is thought that the presenilins are involved in the cleavage of the Notch receptor, such that they either directly regulate gamma-secretase activity or themselves are protease enzymes. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene, the full-length nature of only some have been determined. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deformed axial skeletons, reduced Notch signaling, impaired brain growth with a deficiency of neural stem cells, cerebral hemorrhages, inhibited cleavage of amyloid precursor protein, and perinatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,588,625 I51V probably benign Het
Agbl2 A G 2: 90,803,197 K559R probably benign Het
Arhgap30 A G 1: 171,408,050 D664G probably benign Het
BC034090 A G 1: 155,213,650 V798A probably damaging Het
Bdp1 A T 13: 100,030,794 C2237* probably null Het
C3 C T 17: 57,223,938 V388M probably damaging Het
Ccdc170 G A 10: 4,514,200 E60K probably damaging Het
Cdh8 G A 8: 99,279,550 T135M probably damaging Het
Cep131 G T 11: 120,070,609 A572E probably damaging Het
Clec16a A G 16: 10,741,791 Y976C probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Eno3 A G 11: 70,662,214 I393V probably benign Het
Fbxo47 A G 11: 97,857,694 V305A probably benign Het
Fry G A 5: 150,429,854 V1779M probably benign Het
Gm15293 A T 8: 21,201,680 D26V probably damaging Het
Gtse1 T C 15: 85,864,264 probably null Het
Gucy2e A T 11: 69,235,570 L328Q probably damaging Het
Ifi207 T C 1: 173,730,498 T225A unknown Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lamc3 A T 2: 31,887,344 M1L probably benign Het
Lman1l G A 9: 57,615,619 R153* probably null Het
Myo16 A G 8: 10,569,745 D1432G probably benign Het
Nwd2 A T 5: 63,806,037 N988I probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp14 T C 16: 35,857,279 E773G probably benign Het
Ptx4 G A 17: 25,123,178 R209Q probably benign Het
Slc13a2 T C 11: 78,400,808 T340A probably damaging Het
St8sia1 T C 6: 142,963,708 K21E probably damaging Het
Stxbp1 T C 2: 32,794,674 D581G probably benign Het
Sumo2 G A 11: 115,534,660 probably benign Het
Supt5 G A 7: 28,316,083 P910S probably benign Het
Tbc1d30 T C 10: 121,306,838 Q158R possibly damaging Het
Tenm2 T A 11: 36,024,806 H1968L probably damaging Het
Trmt1 T C 8: 84,695,232 Y220H probably damaging Het
Trp73 C T 4: 154,104,838 E60K possibly damaging Het
Ttn A G 2: 76,787,069 Y8026H probably damaging Het
Zar1l A G 5: 150,517,585 probably null Het
Zfp740 T C 15: 102,209,205 Y117H probably damaging Het
Zfp941 G A 7: 140,812,957 probably benign Het
Zp1 C A 19: 10,920,554 V8F possibly damaging Het
Other mutations in Psen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Psen1 APN 12 83730569 missense probably benign 0.01
IGL00793:Psen1 APN 12 83723018 missense probably damaging 0.98
IGL03171:Psen1 APN 12 83714864 missense probably damaging 1.00
hiortron UTSW 12 83724665 missense probably damaging 1.00
R0685:Psen1 UTSW 12 83714820 nonsense probably null
R1394:Psen1 UTSW 12 83724572 missense probably damaging 1.00
R1395:Psen1 UTSW 12 83724572 missense probably damaging 1.00
R1681:Psen1 UTSW 12 83724620 missense probably damaging 1.00
R2257:Psen1 UTSW 12 83714820 missense probably damaging 1.00
R4833:Psen1 UTSW 12 83731778 missense probably benign 0.23
R5077:Psen1 UTSW 12 83724665 missense probably damaging 1.00
R5782:Psen1 UTSW 12 83712459 missense possibly damaging 0.54
R5804:Psen1 UTSW 12 83731700 missense probably damaging 1.00
R7458:Psen1 UTSW 12 83714766 missense probably damaging 1.00
R7494:Psen1 UTSW 12 83728243 missense probably benign 0.19
R7797:Psen1 UTSW 12 83699622 missense probably benign 0.02
R8547:Psen1 UTSW 12 83714856 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GCAGACCTCACAGTGAATTACAG -3'
(R):5'- TCTTTGCTAGACCAAGTCAAGAC -3'

Sequencing Primer
(F):5'- GTGAATTACAGTTTTAAGAGTGTGC -3'
(R):5'- GCTCAGAACGTGACGCTTAC -3'
Posted On2016-07-06