Mutagenetix > Incidental Mutations

Incidental Mutation 'R5170:Bdp1'

397521

Institutional Source

Beutler Lab

Gene Symbol

Bdp1

Ensembl Gene

ENSMUSG00000049658

Gene Name

B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB

Synonyms

TAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik

MMRRC Submission

042750-MU

Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5170 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100017994-100104070 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 100030794 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 2237 (C2237*)

Ref Sequence

ENSEMBL: ENSMUSP00000105005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]

Predicted Effect

probably null
Transcript: ENSMUST00000038104
AA Change: C2237*

SMART Domains

Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: C2237*

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	375	399	N/A	INTRINSIC
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	3.56e-18	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	3.56e-18	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099262

Predicted Effect

probably null
Transcript: ENSMUST00000109379
AA Change: C2237*

SMART Domains

Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: C2237*

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	4.79e-19	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	4.79e-19	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	A	G	5: 35,588,625	I51V	probably benign	Het
Agbl2	A	G	2: 90,803,197	K559R	probably benign	Het
Arhgap30	A	G	1: 171,408,050	D664G	probably benign	Het
BC034090	A	G	1: 155,213,650	V798A	probably damaging	Het
C3	C	T	17: 57,223,938	V388M	probably damaging	Het
Ccdc170	G	A	10: 4,514,200	E60K	probably damaging	Het
Cdh8	G	A	8: 99,279,550	T135M	probably damaging	Het
Cep131	G	T	11: 120,070,609	A572E	probably damaging	Het
Clec16a	A	G	16: 10,741,791	Y976C	probably benign	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
Eno3	A	G	11: 70,662,214	I393V	probably benign	Het
Fbxo47	A	G	11: 97,857,694	V305A	probably benign	Het
Fry	G	A	5: 150,429,854	V1779M	probably benign	Het
Gm15293	A	T	8: 21,201,680	D26V	probably damaging	Het
Gtse1	T	C	15: 85,864,264		probably null	Het
Gucy2e	A	T	11: 69,235,570	L328Q	probably damaging	Het
Ifi207	T	C	1: 173,730,498	T225A	unknown	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Lamc3	A	T	2: 31,887,344	M1L	probably benign	Het
Lman1l	G	A	9: 57,615,619	R153*	probably null	Het
Myo16	A	G	8: 10,569,745	D1432G	probably benign	Het
Nwd2	A	T	5: 63,806,037	N988I	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Parp14	T	C	16: 35,857,279	E773G	probably benign	Het
Psen1	T	A	12: 83,714,862	M146K	probably damaging	Het
Ptx4	G	A	17: 25,123,178	R209Q	probably benign	Het
Slc13a2	T	C	11: 78,400,808	T340A	probably damaging	Het
St8sia1	T	C	6: 142,963,708	K21E	probably damaging	Het
Stxbp1	T	C	2: 32,794,674	D581G	probably benign	Het
Sumo2	G	A	11: 115,534,660		probably benign	Het
Supt5	G	A	7: 28,316,083	P910S	probably benign	Het
Tbc1d30	T	C	10: 121,306,838	Q158R	possibly damaging	Het
Tenm2	T	A	11: 36,024,806	H1968L	probably damaging	Het
Trmt1	T	C	8: 84,695,232	Y220H	probably damaging	Het
Trp73	C	T	4: 154,104,838	E60K	possibly damaging	Het
Ttn	A	G	2: 76,787,069	Y8026H	probably damaging	Het
Zar1l	A	G	5: 150,517,585		probably null	Het
Zfp740	T	C	15: 102,209,205	Y117H	probably damaging	Het
Zfp941	G	A	7: 140,812,957		probably benign	Het
Zp1	C	A	19: 10,920,554	V8F	possibly damaging	Het

Other mutations in Bdp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Bdp1	APN	13	100098510	missense	probably damaging	1.00
IGL00096:Bdp1	APN	13	100060865	missense	possibly damaging	0.61
IGL00160:Bdp1	APN	13	100061198	missense	probably benign	0.00
IGL00924:Bdp1	APN	13	100097579	missense	possibly damaging	0.89
IGL01337:Bdp1	APN	13	100056192	missense	probably benign	0.00
IGL01344:Bdp1	APN	13	100078080	missense	probably benign	0.06
IGL01347:Bdp1	APN	13	100070203	missense	possibly damaging	0.79
IGL01620:Bdp1	APN	13	100084205	splice site	probably benign
IGL01871:Bdp1	APN	13	100066053	missense	probably benign	0.01
IGL02008:Bdp1	APN	13	100023827	missense	possibly damaging	0.92
IGL02112:Bdp1	APN	13	100037800	missense	probably benign	0.02
IGL02214:Bdp1	APN	13	100041535	missense	probably benign	0.00
IGL02236:Bdp1	APN	13	100060891	missense	probably benign
IGL02307:Bdp1	APN	13	100093438	missense	probably damaging	1.00
IGL02364:Bdp1	APN	13	100055308	splice site	probably benign
IGL02415:Bdp1	APN	13	100089408	missense	probably damaging	0.96
IGL02601:Bdp1	APN	13	100098514	missense	possibly damaging	0.72
IGL02605:Bdp1	APN	13	100078115	critical splice acceptor site	probably null
IGL02664:Bdp1	APN	13	100051539	missense	probably benign	0.29
IGL02738:Bdp1	APN	13	100051353	missense	probably benign	0.26
IGL02754:Bdp1	APN	13	100060973	missense	possibly damaging	0.94
IGL02967:Bdp1	APN	13	100042270	missense	possibly damaging	0.92
IGL02974:Bdp1	APN	13	100055292	missense	probably benign	0.00
IGL03156:Bdp1	APN	13	100061036	missense	probably benign	0.44
IGL03166:Bdp1	APN	13	100035800	missense	probably benign	0.28
IGL03232:Bdp1	APN	13	100051481	missense	probably damaging	1.00
D3080:Bdp1	UTSW	13	100023621	missense	probably benign	0.02
R0115:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0481:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0619:Bdp1	UTSW	13	100037858	missense	probably benign	0.00
R0730:Bdp1	UTSW	13	100058951	splice site	probably benign
R0744:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R0833:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R1307:Bdp1	UTSW	13	100049763	missense	possibly damaging	0.89
R1325:Bdp1	UTSW	13	100099008	missense	probably damaging	0.97
R1346:Bdp1	UTSW	13	100078755	nonsense	probably null
R1644:Bdp1	UTSW	13	100060940	missense	probably benign	0.03
R1670:Bdp1	UTSW	13	100027433	critical splice donor site	probably null
R1836:Bdp1	UTSW	13	100035145	missense	probably benign
R1869:Bdp1	UTSW	13	100042201	missense	probably damaging	0.99
R1920:Bdp1	UTSW	13	100098589	missense	probably benign	0.30
R1944:Bdp1	UTSW	13	100074381	splice site	probably null
R2030:Bdp1	UTSW	13	100061189	missense	probably benign	0.00
R2069:Bdp1	UTSW	13	100050988	missense	probably benign	0.00
R2180:Bdp1	UTSW	13	100061405	small insertion	probably benign
R2263:Bdp1	UTSW	13	100066037	missense	probably damaging	0.96
R2277:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2277:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2278:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2278:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2336:Bdp1	UTSW	13	100053002	missense	probably damaging	0.99
R2380:Bdp1	UTSW	13	100060370	missense	probably benign	0.08
R3154:Bdp1	UTSW	13	100049814	missense	probably damaging	1.00
R4212:Bdp1	UTSW	13	100059585	missense	probably benign
R4322:Bdp1	UTSW	13	100092223	missense	probably damaging	0.97
R4414:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4415:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4764:Bdp1	UTSW	13	100056267	missense	probably damaging	0.99
R4766:Bdp1	UTSW	13	100049868	missense	probably damaging	0.96
R4888:Bdp1	UTSW	13	100051119	missense	probably benign	0.26
R4914:Bdp1	UTSW	13	100056336	missense	probably benign	0.28
R4917:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R4918:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R5266:Bdp1	UTSW	13	100067535	missense	probably benign	0.33
R5312:Bdp1	UTSW	13	100097601	splice site	probably null
R5420:Bdp1	UTSW	13	100066043	missense	possibly damaging	0.88
R5486:Bdp1	UTSW	13	100098510	missense	probably damaging	1.00
R5909:Bdp1	UTSW	13	100092286	missense	probably benign	0.08
R5913:Bdp1	UTSW	13	100051104	missense	probably benign	0.41
R6018:Bdp1	UTSW	13	100038224	missense	probably benign	0.00
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6700:Bdp1	UTSW	13	100025528	missense	probably benign	0.00
R6969:Bdp1	UTSW	13	100074531	missense	probably damaging	0.97
R6972:Bdp1	UTSW	13	100037761	missense	probably null	1.00
R6996:Bdp1	UTSW	13	100043813	missense	probably damaging	1.00
R7043:Bdp1	UTSW	13	100078707	missense	probably benign	0.03
R7060:Bdp1	UTSW	13	100059494	missense	probably damaging	1.00
R7105:Bdp1	UTSW	13	100070181	missense	probably damaging	1.00
R7155:Bdp1	UTSW	13	100061151	missense	possibly damaging	0.93
R7175:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7177:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7327:Bdp1	UTSW	13	100041532	missense	probably damaging	0.97
R7512:Bdp1	UTSW	13	100050949	missense	probably benign	0.03
R7562:Bdp1	UTSW	13	100025541	missense	probably benign	0.04
R7583:Bdp1	UTSW	13	100049812	missense	probably damaging	1.00
R7788:Bdp1	UTSW	13	100055251	missense	possibly damaging	0.64
R7842:Bdp1	UTSW	13	100099129	missense	probably damaging	1.00
R7850:Bdp1	UTSW	13	100092324	missense	probably damaging	1.00
R7904:Bdp1	UTSW	13	100041436	missense	probably benign	0.37
R7975:Bdp1	UTSW	13	100020376	missense	probably benign	0.01
R7999:Bdp1	UTSW	13	100058896	missense	possibly damaging	0.93
R8126:Bdp1	UTSW	13	100056282	missense	probably damaging	1.00
R8340:Bdp1	UTSW	13	100065968	missense	possibly damaging	0.61
R8414:Bdp1	UTSW	13	100064477	missense	probably benign	0.03
R8468:Bdp1	UTSW	13	100060568	missense	probably benign	0.04
RF003:Bdp1	UTSW	13	100060449	missense	probably benign	0.31
RF003:Bdp1	UTSW	13	100060450	missense	probably benign	0.31
Z1177:Bdp1	UTSW	13	100061396	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCCACTGTAGGTTTCCTG -3'
(R):5'- TTGGTTGTTCAAGATGCTCCATC -3'

Sequencing Primer
(F):5'- AGCCACTGTAGGTTTCCTGATTAATG -3'
(R):5'- CCTTATCTCCTTCTAGAAGTGGCAG -3'

Posted On

2016-07-06