Incidental Mutation 'R5170:Zfp740'
ID397524
Institutional Source Beutler Lab
Gene Symbol Zfp740
Ensembl Gene ENSMUSG00000046897
Gene Namezinc finger protein 740
Synonyms
MMRRC Submission 042750-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5170 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102203249-102215606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102209205 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 117 (Y117H)
Ref Sequence ENSEMBL: ENSMUSP00000112985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118729] [ENSMUST00000119168] [ENSMUST00000119800] [ENSMUST00000121206] [ENSMUST00000133986] [ENSMUST00000139960] [ENSMUST00000141465] [ENSMUST00000229345] [ENSMUST00000229514] [ENSMUST00000229886] [ENSMUST00000230867] [ENSMUST00000231030] [ENSMUST00000230687]
Predicted Effect probably damaging
Transcript: ENSMUST00000118729
AA Change: Y117H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112985
Gene: ENSMUSG00000046897
AA Change: Y117H

DomainStartEndE-ValueType
low complexity region 53 62 N/A INTRINSIC
ZnF_C2H2 76 98 3.07e-1 SMART
ZnF_C2H2 104 126 1.69e-3 SMART
ZnF_C2H2 132 152 4.99e1 SMART
Predicted Effect silent
Transcript: ENSMUST00000119168
Predicted Effect probably damaging
Transcript: ENSMUST00000119800
AA Change: Y129H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113770
Gene: ENSMUSG00000046897
AA Change: Y129H

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
ZnF_C2H2 88 110 3.07e-1 SMART
ZnF_C2H2 116 138 1.69e-3 SMART
ZnF_C2H2 144 164 4.99e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119830
SMART Domains Protein: ENSMUSP00000113281
Gene: ENSMUSG00000046897

DomainStartEndE-ValueType
ZnF_C2H2 25 47 3.07e-1 SMART
ZnF_C2H2 53 75 1.69e-3 SMART
ZnF_C2H2 81 101 4.99e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123528
Predicted Effect probably benign
Transcript: ENSMUST00000133986
SMART Domains Protein: ENSMUSP00000122429
Gene: ENSMUSG00000046897

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139960
SMART Domains Protein: ENSMUSP00000117024
Gene: ENSMUSG00000046897

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
Blast:ZnF_C2H2 88 107 9e-7 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000141465
AA Change: Y154H
Predicted Effect probably benign
Transcript: ENSMUST00000229345
Predicted Effect probably benign
Transcript: ENSMUST00000229514
Predicted Effect probably benign
Transcript: ENSMUST00000229886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230328
Predicted Effect possibly damaging
Transcript: ENSMUST00000230867
AA Change: Y92H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000231030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230600
Predicted Effect probably benign
Transcript: ENSMUST00000230687
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,588,625 I51V probably benign Het
Agbl2 A G 2: 90,803,197 K559R probably benign Het
Arhgap30 A G 1: 171,408,050 D664G probably benign Het
BC034090 A G 1: 155,213,650 V798A probably damaging Het
Bdp1 A T 13: 100,030,794 C2237* probably null Het
C3 C T 17: 57,223,938 V388M probably damaging Het
Ccdc170 G A 10: 4,514,200 E60K probably damaging Het
Cdh8 G A 8: 99,279,550 T135M probably damaging Het
Cep131 G T 11: 120,070,609 A572E probably damaging Het
Clec16a A G 16: 10,741,791 Y976C probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Eno3 A G 11: 70,662,214 I393V probably benign Het
Fbxo47 A G 11: 97,857,694 V305A probably benign Het
Fry G A 5: 150,429,854 V1779M probably benign Het
Gm15293 A T 8: 21,201,680 D26V probably damaging Het
Gtse1 T C 15: 85,864,264 probably null Het
Gucy2e A T 11: 69,235,570 L328Q probably damaging Het
Ifi207 T C 1: 173,730,498 T225A unknown Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lamc3 A T 2: 31,887,344 M1L probably benign Het
Lman1l G A 9: 57,615,619 R153* probably null Het
Myo16 A G 8: 10,569,745 D1432G probably benign Het
Nwd2 A T 5: 63,806,037 N988I probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp14 T C 16: 35,857,279 E773G probably benign Het
Psen1 T A 12: 83,714,862 M146K probably damaging Het
Ptx4 G A 17: 25,123,178 R209Q probably benign Het
Slc13a2 T C 11: 78,400,808 T340A probably damaging Het
St8sia1 T C 6: 142,963,708 K21E probably damaging Het
Stxbp1 T C 2: 32,794,674 D581G probably benign Het
Sumo2 G A 11: 115,534,660 probably benign Het
Supt5 G A 7: 28,316,083 P910S probably benign Het
Tbc1d30 T C 10: 121,306,838 Q158R possibly damaging Het
Tenm2 T A 11: 36,024,806 H1968L probably damaging Het
Trmt1 T C 8: 84,695,232 Y220H probably damaging Het
Trp73 C T 4: 154,104,838 E60K possibly damaging Het
Ttn A G 2: 76,787,069 Y8026H probably damaging Het
Zar1l A G 5: 150,517,585 probably null Het
Zfp941 G A 7: 140,812,957 probably benign Het
Zp1 C A 19: 10,920,554 V8F possibly damaging Het
Other mutations in Zfp740
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02165:Zfp740 APN 15 102212674 missense possibly damaging 0.66
R0432:Zfp740 UTSW 15 102212659 missense possibly damaging 0.66
R0659:Zfp740 UTSW 15 102212659 missense possibly damaging 0.66
R0661:Zfp740 UTSW 15 102212659 missense possibly damaging 0.66
R1666:Zfp740 UTSW 15 102208318 missense probably damaging 1.00
R1830:Zfp740 UTSW 15 102207901 missense probably damaging 1.00
R3983:Zfp740 UTSW 15 102208243 missense probably benign 0.06
R4686:Zfp740 UTSW 15 102208749 unclassified probably benign
R4991:Zfp740 UTSW 15 102208279 splice site probably null
R5213:Zfp740 UTSW 15 102212647 missense possibly damaging 0.68
R5782:Zfp740 UTSW 15 102208366 unclassified probably benign
R6088:Zfp740 UTSW 15 102208808 missense probably damaging 1.00
R6848:Zfp740 UTSW 15 102208808 missense probably benign 0.24
R8526:Zfp740 UTSW 15 102208291 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGAGAGTATTAGACGTGG -3'
(R):5'- ATGATGAGGTCCCTAAGGCC -3'

Sequencing Primer
(F):5'- CAGAGAGGTTGCATGGCTC -3'
(R):5'- CCTAAGGCCAGAGTTGTGTCTC -3'
Posted On2016-07-06