Incidental Mutation 'R5170:Ptx4'
ID397527
Institutional Source Beutler Lab
Gene Symbol Ptx4
Ensembl Gene ENSMUSG00000044172
Gene Namepentraxin 4
Synonyms
MMRRC Submission 042750-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R5170 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25120760-25125268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25123178 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 209 (R209Q)
Ref Sequence ENSEMBL: ENSMUSP00000055984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054930]
Predicted Effect probably benign
Transcript: ENSMUST00000054930
AA Change: R209Q

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000055984
Gene: ENSMUSG00000044172
AA Change: R209Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:HOX 32 122 3e-35 BLAST
coiled coil region 147 182 N/A INTRINSIC
Pfam:Pentaxin 271 460 7.3e-33 PFAM
Pfam:Laminin_G_3 277 440 2.4e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the pentraxin superfamily, whose members encode highly conserved multifunctional proteins. The encoded protein, like other members of this family, contains a conserved pentraxin domain at the C-terminus. The highest levels of expression of the protein were observed in bone marrow, small intestine and testes. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,588,625 I51V probably benign Het
Agbl2 A G 2: 90,803,197 K559R probably benign Het
Arhgap30 A G 1: 171,408,050 D664G probably benign Het
BC034090 A G 1: 155,213,650 V798A probably damaging Het
Bdp1 A T 13: 100,030,794 C2237* probably null Het
C3 C T 17: 57,223,938 V388M probably damaging Het
Ccdc170 G A 10: 4,514,200 E60K probably damaging Het
Cdh8 G A 8: 99,279,550 T135M probably damaging Het
Cep131 G T 11: 120,070,609 A572E probably damaging Het
Clec16a A G 16: 10,741,791 Y976C probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Eno3 A G 11: 70,662,214 I393V probably benign Het
Fbxo47 A G 11: 97,857,694 V305A probably benign Het
Fry G A 5: 150,429,854 V1779M probably benign Het
Gm15293 A T 8: 21,201,680 D26V probably damaging Het
Gtse1 T C 15: 85,864,264 probably null Het
Gucy2e A T 11: 69,235,570 L328Q probably damaging Het
Ifi207 T C 1: 173,730,498 T225A unknown Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lamc3 A T 2: 31,887,344 M1L probably benign Het
Lman1l G A 9: 57,615,619 R153* probably null Het
Myo16 A G 8: 10,569,745 D1432G probably benign Het
Nwd2 A T 5: 63,806,037 N988I probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp14 T C 16: 35,857,279 E773G probably benign Het
Psen1 T A 12: 83,714,862 M146K probably damaging Het
Slc13a2 T C 11: 78,400,808 T340A probably damaging Het
St8sia1 T C 6: 142,963,708 K21E probably damaging Het
Stxbp1 T C 2: 32,794,674 D581G probably benign Het
Sumo2 G A 11: 115,534,660 probably benign Het
Supt5 G A 7: 28,316,083 P910S probably benign Het
Tbc1d30 T C 10: 121,306,838 Q158R possibly damaging Het
Tenm2 T A 11: 36,024,806 H1968L probably damaging Het
Trmt1 T C 8: 84,695,232 Y220H probably damaging Het
Trp73 C T 4: 154,104,838 E60K possibly damaging Het
Ttn A G 2: 76,787,069 Y8026H probably damaging Het
Zar1l A G 5: 150,517,585 probably null Het
Zfp740 T C 15: 102,209,205 Y117H probably damaging Het
Zfp941 G A 7: 140,812,957 probably benign Het
Zp1 C A 19: 10,920,554 V8F possibly damaging Het
Other mutations in Ptx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03027:Ptx4 APN 17 25125048 missense possibly damaging 0.81
IGL03373:Ptx4 APN 17 25120899 missense probably benign 0.02
IGL03394:Ptx4 APN 17 25124675 missense probably damaging 1.00
R0559:Ptx4 UTSW 17 25123108 nonsense probably null
R3765:Ptx4 UTSW 17 25122868 missense probably benign 0.02
R4629:Ptx4 UTSW 17 25122763 missense probably damaging 1.00
R4677:Ptx4 UTSW 17 25123126 missense probably benign 0.05
R4938:Ptx4 UTSW 17 25123165 nonsense probably null
R5517:Ptx4 UTSW 17 25124786 missense possibly damaging 0.58
R6614:Ptx4 UTSW 17 25122702 missense possibly damaging 0.70
R6993:Ptx4 UTSW 17 25124924 missense possibly damaging 0.70
R7070:Ptx4 UTSW 17 25122997 missense probably benign 0.04
R7230:Ptx4 UTSW 17 25123103 missense possibly damaging 0.95
R7501:Ptx4 UTSW 17 25125192 missense possibly damaging 0.95
R7845:Ptx4 UTSW 17 25124954 missense possibly damaging 0.95
R8069:Ptx4 UTSW 17 25122779 missense probably damaging 1.00
R8244:Ptx4 UTSW 17 25122865 missense possibly damaging 0.87
R8370:Ptx4 UTSW 17 25123340 missense possibly damaging 0.90
R8388:Ptx4 UTSW 17 25120923 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATTGCAAGCCTGGCCCTAAG -3'
(R):5'- CTCAGACACTGCTAGGGAAAC -3'

Sequencing Primer
(F):5'- CTAAGCGTTCAGGCACTACAGG -3'
(R):5'- CCTGGAACTTGATAGGGAGGTGAC -3'
Posted On2016-07-06