Mutagenetix > Incidental Mutations

Incidental Mutation 'R5181:Lin9'

397532

Institutional Source

Beutler Lab

Gene Symbol

Lin9

Ensembl Gene

ENSMUSG00000058729

Gene Name

lin-9 homolog (C. elegans)

Synonyms

2700022J23Rik

MMRRC Submission

042761-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5181 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

180641150-180690694 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 180669198 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 351 (L351I)

Ref Sequence

ENSEMBL: ENSMUSP00000141331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000192561] [ENSMUST00000192725] [ENSMUST00000193892]

Predicted Effect

probably benign
Transcript: ENSMUST00000085803
AA Change: L335I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000082959
Gene: ENSMUSG00000058729
AA Change: L335I

Domain	Start	End	E-Value	Type
DIRP	127	232	2.93e-67	SMART
coiled coil region	354	412	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000085804

SMART Domains

Protein: ENSMUSP00000082960
Gene: ENSMUSG00000058729

Domain	Start	End	E-Value	Type
DIRP	127	232	2.93e-67	SMART
coiled coil region	354	412	N/A	INTRINSIC
transmembrane domain	416	438	N/A	INTRINSIC
low complexity region	445	458	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191744

Predicted Effect

probably benign
Transcript: ENSMUST00000192561
AA Change: L351I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000141331
Gene: ENSMUSG00000058729
AA Change: L351I

Domain	Start	End	E-Value	Type
DIRP	143	248	2.2e-71	SMART
coiled coil region	370	428	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192725
AA Change: L311I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000141503
Gene: ENSMUSG00000058729
AA Change: L311I

Domain	Start	End	E-Value	Type
DIRP	103	208	2.2e-71	SMART
coiled coil region	330	388	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193892

SMART Domains

Protein: ENSMUSP00000141530
Gene: ENSMUSG00000058729

Domain	Start	End	E-Value	Type
DIRP	127	232	2.2e-71	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000194638

Meta Mutation Damage Score

0.0673

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that inhibits DNA synthesis and oncogenic transformation through association with the retinoblastoma 1 protein. The encoded protein also interacts with a complex of other cell cycle regulators to repress cell cycle-dependent gene expression in non-dividing cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show increased body weight. Mice homozygous for a gene-trap allele die shortly after implantation with defects in early embryogenesis. Homozygous deletion in adult mice causes premature death, intestinal epithelium atrophy, and abnormal mitosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	T	A	5: 8,714,937	D642E	probably benign	Het
Anxa2	T	C	9: 69,476,065	V54A	probably benign	Het
Ccnb1	C	G	13: 100,781,775	Q121H	possibly damaging	Het
Cdca2	A	G	14: 67,680,165	S595P	probably damaging	Het
Cenpe	G	A	3: 135,242,303	E1208K	probably damaging	Het
Cfh	T	C	1: 140,147,646		probably benign	Het
Colq	T	A	14: 31,557,842	H9L	probably benign	Het
Coq8b	T	C	7: 27,252,322	I403T	possibly damaging	Het
Dcdc2a	C	A	13: 25,202,364	T407K	possibly damaging	Het
Fam198b	A	T	3: 79,886,311	S29C	probably benign	Het
Fam49b	T	A	15: 63,938,677	M234L	probably damaging	Het
Grhl3	T	A	4: 135,559,104	K89*	probably null	Het
Inpp5f	A	G	7: 128,679,831	T519A	probably damaging	Het
Isl2	G	T	9: 55,542,277	R79L	probably benign	Het
Kif9	T	A	9: 110,521,268	D742E	probably damaging	Het
Lgi2	T	A	5: 52,554,450	K176M	probably damaging	Het
Lrch4	A	G	5: 137,629,403	D66G	probably damaging	Het
Milr1	G	A	11: 106,754,980	G116D	probably damaging	Het
Myof	T	C	19: 37,932,623	D1397G	possibly damaging	Het
Neurod2	T	C	11: 98,327,378	H320R	probably benign	Het
Nox3	A	T	17: 3,635,286	Y562*	probably null	Het
Nrap	G	A	19: 56,345,528	H884Y	possibly damaging	Het
Pde3a	T	C	6: 141,481,255		probably null	Het
Pgm2l1	G	A	7: 100,261,758	C303Y	probably benign	Het
Phip	A	G	9: 82,871,190		probably benign	Het
Plxna4	A	G	6: 32,516,997	I228T	probably damaging	Het
Prdm2	A	G	4: 143,134,966	S585P	probably benign	Het
Prpf6	T	C	2: 181,649,546	I718T	probably damaging	Het
Rpp40	T	C	13: 35,896,712		probably null	Het
Skiv2l	T	C	17: 34,844,826	D547G	probably benign	Het
Slc22a22	T	A	15: 57,255,123	Y264F	probably benign	Het
Slc5a4b	A	T	10: 76,060,387	L578*	probably null	Het
Sptan1	A	T	2: 29,993,724		probably benign	Het
St5	T	C	7: 109,556,790	Y251C	probably benign	Het
Sult2a4	T	G	7: 13,988,391	I50L	probably benign	Het
Taar6	T	C	10: 23,984,785	T288A	possibly damaging	Het
Tmem71	C	T	15: 66,555,214	S44N	probably benign	Het
Tmem98	T	C	11: 80,819,932	V139A	probably damaging	Het
Triobp	T	C	15: 78,967,754	Y703H	probably benign	Het
Ttc25	G	A	11: 100,549,893	D67N	probably damaging	Het
Ttc34	A	G	4: 154,862,246	T868A	probably benign	Het
Ttn	C	T	2: 76,834,881		probably benign	Het
Vipas39	A	T	12: 87,239,827	W470R	probably damaging	Het
Vmn2r102	T	C	17: 19,676,741	Y117H	probably benign	Het
Vmn2r111	T	C	17: 22,571,020	N335S	possibly damaging	Het
Vmn2r70	A	G	7: 85,559,179	Y697H	probably damaging	Het
Wnk4	C	A	11: 101,265,377	R461S	probably damaging	Het
Xylb	T	A	9: 119,364,501	L87Q	probably damaging	Het
Zcchc9	T	A	13: 91,797,162	K101*	probably null	Het
Zfp503	C	A	14: 21,985,637	A404S	probably benign	Het
Zhx1	C	G	15: 58,054,074	G259R	probably damaging	Het

Other mutations in Lin9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02220:Lin9	APN	1	180667367	missense	probably damaging	1.00
IGL02221:Lin9	APN	1	180650834	missense	probably benign	0.03
IGL02233:Lin9	APN	1	180689300	missense	probably damaging	0.98
IGL02370:Lin9	APN	1	180688018	missense	probably damaging	1.00
IGL02794:Lin9	APN	1	180651879	missense	probably damaging	1.00
R0278:Lin9	UTSW	1	180665923	missense	probably damaging	1.00
R1488:Lin9	UTSW	1	180688285	missense	possibly damaging	0.61
R3808:Lin9	UTSW	1	180659111	missense	probably null	0.32
R3809:Lin9	UTSW	1	180659111	missense	probably null	0.32
R3884:Lin9	UTSW	1	180688065	nonsense	probably null
R3978:Lin9	UTSW	1	180668792	missense	possibly damaging	0.94
R4600:Lin9	UTSW	1	180681194	missense	probably damaging	0.99
R4625:Lin9	UTSW	1	180689280	missense	probably damaging	0.99
R4730:Lin9	UTSW	1	180665851	nonsense	probably null
R4987:Lin9	UTSW	1	180668764	missense	probably damaging	1.00
R5034:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5035:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5045:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5046:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5148:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5180:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5221:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5222:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5329:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5332:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5633:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5634:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5696:Lin9	UTSW	1	180659081	missense	probably benign	0.00
R5812:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5813:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5814:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5851:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R7046:Lin9	UTSW	1	180667370	missense	probably damaging	1.00
R7084:Lin9	UTSW	1	180688096	missense	probably benign	0.11
Z1177:Lin9	UTSW	1	180650802	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- GCTACTTCAGGACTTGAGCTACC -3'
(R):5'- TTGGAAATAGCAGAGTCCTGAAAAC -3'

Sequencing Primer
(F):5'- CAGGACTTGAGCTACCAATATTATG -3'
(R):5'- GAGTCCTGAAAACCCACATAGTG -3'

Posted On

2016-07-06