Incidental Mutation 'R5181:Lin9'
ID397532
Institutional Source Beutler Lab
Gene Symbol Lin9
Ensembl Gene ENSMUSG00000058729
Gene Namelin-9 homolog (C. elegans)
Synonyms2700022J23Rik
MMRRC Submission 042761-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5181 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180641150-180690694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 180669198 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 351 (L351I)
Ref Sequence ENSEMBL: ENSMUSP00000141331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000192561] [ENSMUST00000192725] [ENSMUST00000193892]
Predicted Effect probably benign
Transcript: ENSMUST00000085803
AA Change: L335I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000082959
Gene: ENSMUSG00000058729
AA Change: L335I

DomainStartEndE-ValueType
DIRP 127 232 2.93e-67 SMART
coiled coil region 354 412 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085804
SMART Domains Protein: ENSMUSP00000082960
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 127 232 2.93e-67 SMART
coiled coil region 354 412 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
low complexity region 445 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191744
Predicted Effect probably benign
Transcript: ENSMUST00000192561
AA Change: L351I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000141331
Gene: ENSMUSG00000058729
AA Change: L351I

DomainStartEndE-ValueType
DIRP 143 248 2.2e-71 SMART
coiled coil region 370 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192725
AA Change: L311I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000141503
Gene: ENSMUSG00000058729
AA Change: L311I

DomainStartEndE-ValueType
DIRP 103 208 2.2e-71 SMART
coiled coil region 330 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193892
SMART Domains Protein: ENSMUSP00000141530
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 127 232 2.2e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194638
Meta Mutation Damage Score 0.0673 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that inhibits DNA synthesis and oncogenic transformation through association with the retinoblastoma 1 protein. The encoded protein also interacts with a complex of other cell cycle regulators to repress cell cycle-dependent gene expression in non-dividing cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show increased body weight. Mice homozygous for a gene-trap allele die shortly after implantation with defects in early embryogenesis. Homozygous deletion in adult mice causes premature death, intestinal epithelium atrophy, and abnormal mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,714,937 D642E probably benign Het
Anxa2 T C 9: 69,476,065 V54A probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdca2 A G 14: 67,680,165 S595P probably damaging Het
Cenpe G A 3: 135,242,303 E1208K probably damaging Het
Cfh T C 1: 140,147,646 probably benign Het
Colq T A 14: 31,557,842 H9L probably benign Het
Coq8b T C 7: 27,252,322 I403T possibly damaging Het
Dcdc2a C A 13: 25,202,364 T407K possibly damaging Het
Fam198b A T 3: 79,886,311 S29C probably benign Het
Fam49b T A 15: 63,938,677 M234L probably damaging Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Inpp5f A G 7: 128,679,831 T519A probably damaging Het
Isl2 G T 9: 55,542,277 R79L probably benign Het
Kif9 T A 9: 110,521,268 D742E probably damaging Het
Lgi2 T A 5: 52,554,450 K176M probably damaging Het
Lrch4 A G 5: 137,629,403 D66G probably damaging Het
Milr1 G A 11: 106,754,980 G116D probably damaging Het
Myof T C 19: 37,932,623 D1397G possibly damaging Het
Neurod2 T C 11: 98,327,378 H320R probably benign Het
Nox3 A T 17: 3,635,286 Y562* probably null Het
Nrap G A 19: 56,345,528 H884Y possibly damaging Het
Pde3a T C 6: 141,481,255 probably null Het
Pgm2l1 G A 7: 100,261,758 C303Y probably benign Het
Phip A G 9: 82,871,190 probably benign Het
Plxna4 A G 6: 32,516,997 I228T probably damaging Het
Prdm2 A G 4: 143,134,966 S585P probably benign Het
Prpf6 T C 2: 181,649,546 I718T probably damaging Het
Rpp40 T C 13: 35,896,712 probably null Het
Skiv2l T C 17: 34,844,826 D547G probably benign Het
Slc22a22 T A 15: 57,255,123 Y264F probably benign Het
Slc5a4b A T 10: 76,060,387 L578* probably null Het
Sptan1 A T 2: 29,993,724 probably benign Het
St5 T C 7: 109,556,790 Y251C probably benign Het
Sult2a4 T G 7: 13,988,391 I50L probably benign Het
Taar6 T C 10: 23,984,785 T288A possibly damaging Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmem98 T C 11: 80,819,932 V139A probably damaging Het
Triobp T C 15: 78,967,754 Y703H probably benign Het
Ttc25 G A 11: 100,549,893 D67N probably damaging Het
Ttc34 A G 4: 154,862,246 T868A probably benign Het
Ttn C T 2: 76,834,881 probably benign Het
Vipas39 A T 12: 87,239,827 W470R probably damaging Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Vmn2r111 T C 17: 22,571,020 N335S possibly damaging Het
Vmn2r70 A G 7: 85,559,179 Y697H probably damaging Het
Wnk4 C A 11: 101,265,377 R461S probably damaging Het
Xylb T A 9: 119,364,501 L87Q probably damaging Het
Zcchc9 T A 13: 91,797,162 K101* probably null Het
Zfp503 C A 14: 21,985,637 A404S probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Lin9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Lin9 APN 1 180667367 missense probably damaging 1.00
IGL02221:Lin9 APN 1 180650834 missense probably benign 0.03
IGL02233:Lin9 APN 1 180689300 missense probably damaging 0.98
IGL02370:Lin9 APN 1 180688018 missense probably damaging 1.00
IGL02794:Lin9 APN 1 180651879 missense probably damaging 1.00
R0278:Lin9 UTSW 1 180665923 missense probably damaging 1.00
R1488:Lin9 UTSW 1 180688285 missense possibly damaging 0.61
R3808:Lin9 UTSW 1 180659111 missense probably null 0.32
R3809:Lin9 UTSW 1 180659111 missense probably null 0.32
R3884:Lin9 UTSW 1 180688065 nonsense probably null
R3978:Lin9 UTSW 1 180668792 missense possibly damaging 0.94
R4600:Lin9 UTSW 1 180681194 missense probably damaging 0.99
R4625:Lin9 UTSW 1 180689280 missense probably damaging 0.99
R4730:Lin9 UTSW 1 180665851 nonsense probably null
R4987:Lin9 UTSW 1 180668764 missense probably damaging 1.00
R5034:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5035:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5045:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5046:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5148:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5180:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5221:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5222:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5329:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5332:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5633:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5634:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5696:Lin9 UTSW 1 180659081 missense probably benign 0.00
R5812:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5813:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5814:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5851:Lin9 UTSW 1 180669198 missense probably benign 0.01
R7046:Lin9 UTSW 1 180667370 missense probably damaging 1.00
R7084:Lin9 UTSW 1 180688096 missense probably benign 0.11
Z1177:Lin9 UTSW 1 180650802 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTACTTCAGGACTTGAGCTACC -3'
(R):5'- TTGGAAATAGCAGAGTCCTGAAAAC -3'

Sequencing Primer
(F):5'- CAGGACTTGAGCTACCAATATTATG -3'
(R):5'- GAGTCCTGAAAACCCACATAGTG -3'
Posted On2016-07-06