Incidental Mutation 'R5181:Ttc34'
ID397540
Institutional Source Beutler Lab
Gene Symbol Ttc34
Ensembl Gene ENSMUSG00000046637
Gene Nametetratricopeptide repeat domain 34
Synonyms
MMRRC Submission 042761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R5181 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154837459-154867127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154862246 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 868 (T868A)
Ref Sequence ENSEMBL: ENSMUSP00000146409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050220] [ENSMUST00000207854]
Predicted Effect probably benign
Transcript: ENSMUST00000050220
AA Change: T359A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051782
Gene: ENSMUSG00000046637
AA Change: T359A

DomainStartEndE-ValueType
Blast:TPR 38 68 4e-6 BLAST
low complexity region 69 85 N/A INTRINSIC
TPR 166 199 2.66e0 SMART
TPR 200 233 4.45e-2 SMART
TPR 294 327 9e1 SMART
Blast:TPR 328 361 2e-7 BLAST
TPR 412 445 8.77e1 SMART
TPR 452 485 1.78e-1 SMART
Blast:TPR 500 533 9e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151696
Predicted Effect probably benign
Transcript: ENSMUST00000207854
AA Change: T868A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,714,937 D642E probably benign Het
Anxa2 T C 9: 69,476,065 V54A probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdca2 A G 14: 67,680,165 S595P probably damaging Het
Cenpe G A 3: 135,242,303 E1208K probably damaging Het
Cfh T C 1: 140,147,646 probably benign Het
Colq T A 14: 31,557,842 H9L probably benign Het
Coq8b T C 7: 27,252,322 I403T possibly damaging Het
Dcdc2a C A 13: 25,202,364 T407K possibly damaging Het
Fam198b A T 3: 79,886,311 S29C probably benign Het
Fam49b T A 15: 63,938,677 M234L probably damaging Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Inpp5f A G 7: 128,679,831 T519A probably damaging Het
Isl2 G T 9: 55,542,277 R79L probably benign Het
Kif9 T A 9: 110,521,268 D742E probably damaging Het
Lgi2 T A 5: 52,554,450 K176M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrch4 A G 5: 137,629,403 D66G probably damaging Het
Milr1 G A 11: 106,754,980 G116D probably damaging Het
Myof T C 19: 37,932,623 D1397G possibly damaging Het
Neurod2 T C 11: 98,327,378 H320R probably benign Het
Nox3 A T 17: 3,635,286 Y562* probably null Het
Nrap G A 19: 56,345,528 H884Y possibly damaging Het
Pde3a T C 6: 141,481,255 probably null Het
Pgm2l1 G A 7: 100,261,758 C303Y probably benign Het
Phip A G 9: 82,871,190 probably benign Het
Plxna4 A G 6: 32,516,997 I228T probably damaging Het
Prdm2 A G 4: 143,134,966 S585P probably benign Het
Prpf6 T C 2: 181,649,546 I718T probably damaging Het
Rpp40 T C 13: 35,896,712 probably null Het
Skiv2l T C 17: 34,844,826 D547G probably benign Het
Slc22a22 T A 15: 57,255,123 Y264F probably benign Het
Slc5a4b A T 10: 76,060,387 L578* probably null Het
Sptan1 A T 2: 29,993,724 probably benign Het
St5 T C 7: 109,556,790 Y251C probably benign Het
Sult2a4 T G 7: 13,988,391 I50L probably benign Het
Taar6 T C 10: 23,984,785 T288A possibly damaging Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmem98 T C 11: 80,819,932 V139A probably damaging Het
Triobp T C 15: 78,967,754 Y703H probably benign Het
Ttc25 G A 11: 100,549,893 D67N probably damaging Het
Ttn C T 2: 76,834,881 probably benign Het
Vipas39 A T 12: 87,239,827 W470R probably damaging Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Vmn2r111 T C 17: 22,571,020 N335S possibly damaging Het
Vmn2r70 A G 7: 85,559,179 Y697H probably damaging Het
Wnk4 C A 11: 101,265,377 R461S probably damaging Het
Xylb T A 9: 119,364,501 L87Q probably damaging Het
Zcchc9 T A 13: 91,797,162 K101* probably null Het
Zfp503 C A 14: 21,985,637 A404S probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Ttc34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03000:Ttc34 APN 4 154865431 missense probably damaging 1.00
IGL03034:Ttc34 APN 4 154861183 missense probably damaging 1.00
IGL03139:Ttc34 APN 4 154861270 missense probably benign 0.04
R1205:Ttc34 UTSW 4 154862214 missense probably benign 0.01
R1775:Ttc34 UTSW 4 154862214 missense probably benign 0.00
R1935:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1936:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1937:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1939:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1940:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R3701:Ttc34 UTSW 4 154865482 missense probably damaging 1.00
R5845:Ttc34 UTSW 4 154865472 missense probably benign 0.08
R6603:Ttc34 UTSW 4 154839305 missense probably benign 0.34
R6930:Ttc34 UTSW 4 154839086 missense probably damaging 0.99
R7209:Ttc34 UTSW 4 154839128 missense probably damaging 1.00
R7548:Ttc34 UTSW 4 154856359 missense probably damaging 1.00
R7640:Ttc34 UTSW 4 154861384 missense probably benign
R7727:Ttc34 UTSW 4 154839274 missense possibly damaging 0.81
R7856:Ttc34 UTSW 4 154861286 missense probably benign
R7893:Ttc34 UTSW 4 154861300 missense probably benign 0.05
R7894:Ttc34 UTSW 4 154859383 missense probably damaging 1.00
R7939:Ttc34 UTSW 4 154861286 missense probably benign
R7976:Ttc34 UTSW 4 154861300 missense probably benign 0.05
R7977:Ttc34 UTSW 4 154859383 missense probably damaging 1.00
Z1177:Ttc34 UTSW 4 154865397 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CCCAAGACAGAGTAGGGGTCA -3'
(R):5'- CCAGGTCCGGGCTTCTTAC -3'

Sequencing Primer
(F):5'- TAGGGGTCATCAGAGTAGCTCC -3'
(R):5'- AGGTCCGGGCTTCTTACTCTAC -3'
Posted On2016-07-06