Incidental Mutation 'R5181:Lgi2'
ID397542
Institutional Source Beutler Lab
Gene Symbol Lgi2
Ensembl Gene ENSMUSG00000039252
Gene Nameleucine-rich repeat LGI family, member 2
Synonyms
MMRRC Submission 042761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5181 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location52533517-52566462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52554450 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 176 (K176M)
Ref Sequence ENSEMBL: ENSMUSP00000040436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039750] [ENSMUST00000199942]
Predicted Effect probably damaging
Transcript: ENSMUST00000039750
AA Change: K176M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040436
Gene: ENSMUSG00000039252
AA Change: K176M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:LRRNT 32 62 9e-15 BLAST
LRR_TYP 81 104 7.26e-3 SMART
LRR_TYP 105 128 4.72e-2 SMART
LRRCT 140 189 4.49e-4 SMART
Pfam:EPTP 224 265 3.9e-12 PFAM
Pfam:EPTP 270 311 2e-13 PFAM
Pfam:EPTP 316 362 2.1e-16 PFAM
Pfam:EPTP 365 407 2.3e-9 PFAM
Pfam:EPTP 412 454 4.8e-12 PFAM
Pfam:EPTP 457 498 2.7e-14 PFAM
low complexity region 499 509 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199942
AA Change: K200M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143707
Gene: ENSMUSG00000039252
AA Change: K200M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:LRRNT 32 62 7e-15 BLAST
LRR_TYP 81 104 7.26e-3 SMART
LRR_TYP 105 128 4.72e-2 SMART
LRR_TYP 129 152 5.99e-4 SMART
LRRCT 164 213 4.49e-4 SMART
Pfam:EPTP 216 257 5.6e-12 PFAM
Pfam:EPTP 262 303 2.8e-13 PFAM
Pfam:EPTP 308 354 3e-16 PFAM
Pfam:EPTP 357 399 3.3e-9 PFAM
Pfam:EPTP 404 446 6.8e-12 PFAM
Pfam:EPTP 449 490 3.8e-14 PFAM
low complexity region 491 501 N/A INTRINSIC
Meta Mutation Damage Score 0.2267 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,714,937 D642E probably benign Het
Anxa2 T C 9: 69,476,065 V54A probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdca2 A G 14: 67,680,165 S595P probably damaging Het
Cenpe G A 3: 135,242,303 E1208K probably damaging Het
Cfh T C 1: 140,147,646 probably benign Het
Colq T A 14: 31,557,842 H9L probably benign Het
Coq8b T C 7: 27,252,322 I403T possibly damaging Het
Dcdc2a C A 13: 25,202,364 T407K possibly damaging Het
Fam198b A T 3: 79,886,311 S29C probably benign Het
Fam49b T A 15: 63,938,677 M234L probably damaging Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Inpp5f A G 7: 128,679,831 T519A probably damaging Het
Isl2 G T 9: 55,542,277 R79L probably benign Het
Kif9 T A 9: 110,521,268 D742E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrch4 A G 5: 137,629,403 D66G probably damaging Het
Milr1 G A 11: 106,754,980 G116D probably damaging Het
Myof T C 19: 37,932,623 D1397G possibly damaging Het
Neurod2 T C 11: 98,327,378 H320R probably benign Het
Nox3 A T 17: 3,635,286 Y562* probably null Het
Nrap G A 19: 56,345,528 H884Y possibly damaging Het
Pde3a T C 6: 141,481,255 probably null Het
Pgm2l1 G A 7: 100,261,758 C303Y probably benign Het
Phip A G 9: 82,871,190 probably benign Het
Plxna4 A G 6: 32,516,997 I228T probably damaging Het
Prdm2 A G 4: 143,134,966 S585P probably benign Het
Prpf6 T C 2: 181,649,546 I718T probably damaging Het
Rpp40 T C 13: 35,896,712 probably null Het
Skiv2l T C 17: 34,844,826 D547G probably benign Het
Slc22a22 T A 15: 57,255,123 Y264F probably benign Het
Slc5a4b A T 10: 76,060,387 L578* probably null Het
Sptan1 A T 2: 29,993,724 probably benign Het
St5 T C 7: 109,556,790 Y251C probably benign Het
Sult2a4 T G 7: 13,988,391 I50L probably benign Het
Taar6 T C 10: 23,984,785 T288A possibly damaging Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmem98 T C 11: 80,819,932 V139A probably damaging Het
Triobp T C 15: 78,967,754 Y703H probably benign Het
Ttc25 G A 11: 100,549,893 D67N probably damaging Het
Ttc34 A G 4: 154,862,246 T868A probably benign Het
Ttn C T 2: 76,834,881 probably benign Het
Vipas39 A T 12: 87,239,827 W470R probably damaging Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Vmn2r111 T C 17: 22,571,020 N335S possibly damaging Het
Vmn2r70 A G 7: 85,559,179 Y697H probably damaging Het
Wnk4 C A 11: 101,265,377 R461S probably damaging Het
Xylb T A 9: 119,364,501 L87Q probably damaging Het
Zcchc9 T A 13: 91,797,162 K101* probably null Het
Zfp503 C A 14: 21,985,637 A404S probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Lgi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Lgi2 APN 5 52538121 missense probably benign
IGL01310:Lgi2 APN 5 52554465 missense probably benign 0.44
IGL02086:Lgi2 APN 5 52565957 missense probably damaging 0.96
IGL03091:Lgi2 APN 5 52563965 critical splice donor site probably null
IGL03367:Lgi2 APN 5 52562160 missense probably damaging 1.00
IGL03388:Lgi2 APN 5 52538477 missense probably damaging 1.00
R0388:Lgi2 UTSW 5 52554549 missense probably damaging 0.99
R0602:Lgi2 UTSW 5 52554423 missense probably damaging 0.98
R0633:Lgi2 UTSW 5 52554460 missense probably damaging 0.97
R1616:Lgi2 UTSW 5 52546638 missense probably benign 0.00
R1916:Lgi2 UTSW 5 52546632 missense probably benign
R2072:Lgi2 UTSW 5 52538505 missense probably damaging 1.00
R2512:Lgi2 UTSW 5 52537965 makesense probably null
R4614:Lgi2 UTSW 5 52538433 missense probably damaging 0.99
R4855:Lgi2 UTSW 5 52538507 missense probably damaging 1.00
R5092:Lgi2 UTSW 5 52538087 missense probably damaging 1.00
R5311:Lgi2 UTSW 5 52554485 missense probably damaging 0.99
R6074:Lgi2 UTSW 5 52546642 missense probably benign
R7089:Lgi2 UTSW 5 52538490 missense probably damaging 0.99
R7376:Lgi2 UTSW 5 52538262 missense probably damaging 0.99
R7396:Lgi2 UTSW 5 52538411 missense probably damaging 1.00
R7733:Lgi2 UTSW 5 52538531 missense probably benign 0.03
R8007:Lgi2 UTSW 5 52566033 missense probably benign 0.01
R8073:Lgi2 UTSW 5 52546671 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATGTTCTCCGAACCCCATTG -3'
(R):5'- AGCACATCAGATATGTCTGCTTC -3'

Sequencing Primer
(F):5'- TTGGACTCAGGTCACCAAACTTGG -3'
(R):5'- AGATATGTCTGCTTCCCTATGTATG -3'
Posted On2016-07-06