Incidental Mutation 'R5181:Lrch4'
ID397543
Institutional Source Beutler Lab
Gene Symbol Lrch4
Ensembl Gene ENSMUSG00000093445
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 4
Synonyms2810008P14Rik, LRN, LRRN4, 2900069C24Rik, SAP25
MMRRC Submission 042761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R5181 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137629121-137641099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137629403 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 66 (D66G)
Ref Sequence ENSEMBL: ENSMUSP00000135286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031732] [ENSMUST00000031734] [ENSMUST00000111002] [ENSMUST00000136028] [ENSMUST00000175968] [ENSMUST00000176011] [ENSMUST00000176667] [ENSMUST00000177477] [ENSMUST00000177545]
Predicted Effect probably benign
Transcript: ENSMUST00000031732
SMART Domains Protein: ENSMUSP00000031732
Gene: ENSMUSG00000089984

DomainStartEndE-ValueType
FBOX 29 69 1.48e-7 SMART
Pfam:RCC1 386 432 2.2e-10 PFAM
low complexity region 442 455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000031734
AA Change: D66G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031734
Gene: ENSMUSG00000093445
AA Change: D66G

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111002
SMART Domains Protein: ENSMUSP00000106630
Gene: ENSMUSG00000089984

DomainStartEndE-ValueType
Pfam:RCC1 247 293 4.2e-11 PFAM
low complexity region 303 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136028
Predicted Effect probably benign
Transcript: ENSMUST00000175968
SMART Domains Protein: ENSMUSP00000134767
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRR 36 58 4.84e1 SMART
LRR_TYP 59 82 4.61e-5 SMART
LRR 104 126 2.63e0 SMART
LRR_TYP 127 150 1.1e-2 SMART
LRR 172 195 3.98e1 SMART
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 420 425 N/A INTRINSIC
low complexity region 456 476 N/A INTRINSIC
CH 479 588 9.24e-15 SMART
transmembrane domain 602 624 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176011
AA Change: D66G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135133
Gene: ENSMUSG00000093445
AA Change: D66G

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176667
AA Change: D66G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135832
Gene: ENSMUSG00000093445
AA Change: D66G

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 648 4.73e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176988
Predicted Effect probably damaging
Transcript: ENSMUST00000177477
AA Change: D66G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135724
Gene: ENSMUSG00000093445
AA Change: D66G

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177545
AA Change: D66G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135286
Gene: ENSMUSG00000029720
AA Change: D66G

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Meta Mutation Damage Score 0.4919 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains leucine-rich repeats (LRR) at its amino terminus and that is known to be involved in ligand binding. The carboxyl terminus may act as a membrane anchor. Identified structural elements suggest that the encoded protein resembles a receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,714,937 D642E probably benign Het
Anxa2 T C 9: 69,476,065 V54A probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdca2 A G 14: 67,680,165 S595P probably damaging Het
Cenpe G A 3: 135,242,303 E1208K probably damaging Het
Cfh T C 1: 140,147,646 probably benign Het
Colq T A 14: 31,557,842 H9L probably benign Het
Coq8b T C 7: 27,252,322 I403T possibly damaging Het
Dcdc2a C A 13: 25,202,364 T407K possibly damaging Het
Fam198b A T 3: 79,886,311 S29C probably benign Het
Fam49b T A 15: 63,938,677 M234L probably damaging Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Inpp5f A G 7: 128,679,831 T519A probably damaging Het
Isl2 G T 9: 55,542,277 R79L probably benign Het
Kif9 T A 9: 110,521,268 D742E probably damaging Het
Lgi2 T A 5: 52,554,450 K176M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Milr1 G A 11: 106,754,980 G116D probably damaging Het
Myof T C 19: 37,932,623 D1397G possibly damaging Het
Neurod2 T C 11: 98,327,378 H320R probably benign Het
Nox3 A T 17: 3,635,286 Y562* probably null Het
Nrap G A 19: 56,345,528 H884Y possibly damaging Het
Pde3a T C 6: 141,481,255 probably null Het
Pgm2l1 G A 7: 100,261,758 C303Y probably benign Het
Phip A G 9: 82,871,190 probably benign Het
Plxna4 A G 6: 32,516,997 I228T probably damaging Het
Prdm2 A G 4: 143,134,966 S585P probably benign Het
Prpf6 T C 2: 181,649,546 I718T probably damaging Het
Rpp40 T C 13: 35,896,712 probably null Het
Skiv2l T C 17: 34,844,826 D547G probably benign Het
Slc22a22 T A 15: 57,255,123 Y264F probably benign Het
Slc5a4b A T 10: 76,060,387 L578* probably null Het
Sptan1 A T 2: 29,993,724 probably benign Het
St5 T C 7: 109,556,790 Y251C probably benign Het
Sult2a4 T G 7: 13,988,391 I50L probably benign Het
Taar6 T C 10: 23,984,785 T288A possibly damaging Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmem98 T C 11: 80,819,932 V139A probably damaging Het
Triobp T C 15: 78,967,754 Y703H probably benign Het
Ttc25 G A 11: 100,549,893 D67N probably damaging Het
Ttc34 A G 4: 154,862,246 T868A probably benign Het
Ttn C T 2: 76,834,881 probably benign Het
Vipas39 A T 12: 87,239,827 W470R probably damaging Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Vmn2r111 T C 17: 22,571,020 N335S possibly damaging Het
Vmn2r70 A G 7: 85,559,179 Y697H probably damaging Het
Wnk4 C A 11: 101,265,377 R461S probably damaging Het
Xylb T A 9: 119,364,501 L87Q probably damaging Het
Zcchc9 T A 13: 91,797,162 K101* probably null Het
Zfp503 C A 14: 21,985,637 A404S probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Lrch4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrch4 APN 5 137637747 missense possibly damaging 0.49
IGL01862:Lrch4 APN 5 137637009 missense probably damaging 1.00
IGL03289:Lrch4 APN 5 137633577 missense probably damaging 1.00
R0144:Lrch4 UTSW 5 137638543 critical splice donor site probably null
R0724:Lrch4 UTSW 5 137637308 missense probably damaging 1.00
R1330:Lrch4 UTSW 5 137637789 missense probably damaging 0.99
R1557:Lrch4 UTSW 5 137637556 missense probably benign 0.00
R1694:Lrch4 UTSW 5 137638461 missense probably benign 0.00
R2358:Lrch4 UTSW 5 137638548 unclassified probably benign
R3755:Lrch4 UTSW 5 137637730 missense probably damaging 1.00
R3756:Lrch4 UTSW 5 137637730 missense probably damaging 1.00
R4608:Lrch4 UTSW 5 137639146 nonsense probably null
R5056:Lrch4 UTSW 5 137636851 missense probably damaging 1.00
R5114:Lrch4 UTSW 5 137637917 missense probably benign
R5325:Lrch4 UTSW 5 137637906 missense probably damaging 1.00
R5430:Lrch4 UTSW 5 137638533 missense possibly damaging 0.46
R5712:Lrch4 UTSW 5 137637926 missense possibly damaging 0.57
R5846:Lrch4 UTSW 5 137633657 missense probably damaging 1.00
R5909:Lrch4 UTSW 5 137633865 missense possibly damaging 0.87
R7319:Lrch4 UTSW 5 137639715 missense
R7525:Lrch4 UTSW 5 137639465 missense probably damaging 1.00
R7761:Lrch4 UTSW 5 137639763 missense
R7848:Lrch4 UTSW 5 137633854 missense probably damaging 1.00
R7931:Lrch4 UTSW 5 137633854 missense probably damaging 1.00
RF009:Lrch4 UTSW 5 137637543 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTCATGATTGGTCCGCGGAG -3'
(R):5'- TGGTTCTTACACAGGGGAGG -3'

Sequencing Primer
(F):5'- TCCCTTCAGTGGGGACTAC -3'
(R):5'- TTCTTACACAGGGGAGGGGAGG -3'
Posted On2016-07-06