Incidental Mutation 'R5181:Pde3a'
ID397545
Institutional Source Beutler Lab
Gene Symbol Pde3a
Ensembl Gene ENSMUSG00000041741
Gene Namephosphodiesterase 3A, cGMP inhibited
SynonymsA930022O17Rik
MMRRC Submission 042761-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R5181 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location141249269-141507448 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 141481255 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043259]
Predicted Effect probably null
Transcript: ENSMUST00000043259
SMART Domains Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 103 121 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 230 252 N/A INTRINSIC
low complexity region 419 445 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
HDc 749 964 3.76e-4 SMART
low complexity region 1028 1056 N/A INTRINSIC
low complexity region 1114 1133 N/A INTRINSIC
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,714,937 D642E probably benign Het
Anxa2 T C 9: 69,476,065 V54A probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdca2 A G 14: 67,680,165 S595P probably damaging Het
Cenpe G A 3: 135,242,303 E1208K probably damaging Het
Cfh T C 1: 140,147,646 probably benign Het
Colq T A 14: 31,557,842 H9L probably benign Het
Coq8b T C 7: 27,252,322 I403T possibly damaging Het
Dcdc2a C A 13: 25,202,364 T407K possibly damaging Het
Fam198b A T 3: 79,886,311 S29C probably benign Het
Fam49b T A 15: 63,938,677 M234L probably damaging Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Inpp5f A G 7: 128,679,831 T519A probably damaging Het
Isl2 G T 9: 55,542,277 R79L probably benign Het
Kif9 T A 9: 110,521,268 D742E probably damaging Het
Lgi2 T A 5: 52,554,450 K176M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrch4 A G 5: 137,629,403 D66G probably damaging Het
Milr1 G A 11: 106,754,980 G116D probably damaging Het
Myof T C 19: 37,932,623 D1397G possibly damaging Het
Neurod2 T C 11: 98,327,378 H320R probably benign Het
Nox3 A T 17: 3,635,286 Y562* probably null Het
Nrap G A 19: 56,345,528 H884Y possibly damaging Het
Pgm2l1 G A 7: 100,261,758 C303Y probably benign Het
Phip A G 9: 82,871,190 probably benign Het
Plxna4 A G 6: 32,516,997 I228T probably damaging Het
Prdm2 A G 4: 143,134,966 S585P probably benign Het
Prpf6 T C 2: 181,649,546 I718T probably damaging Het
Rpp40 T C 13: 35,896,712 probably null Het
Skiv2l T C 17: 34,844,826 D547G probably benign Het
Slc22a22 T A 15: 57,255,123 Y264F probably benign Het
Slc5a4b A T 10: 76,060,387 L578* probably null Het
Sptan1 A T 2: 29,993,724 probably benign Het
St5 T C 7: 109,556,790 Y251C probably benign Het
Sult2a4 T G 7: 13,988,391 I50L probably benign Het
Taar6 T C 10: 23,984,785 T288A possibly damaging Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmem98 T C 11: 80,819,932 V139A probably damaging Het
Triobp T C 15: 78,967,754 Y703H probably benign Het
Ttc25 G A 11: 100,549,893 D67N probably damaging Het
Ttc34 A G 4: 154,862,246 T868A probably benign Het
Ttn C T 2: 76,834,881 probably benign Het
Vipas39 A T 12: 87,239,827 W470R probably damaging Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Vmn2r111 T C 17: 22,571,020 N335S possibly damaging Het
Vmn2r70 A G 7: 85,559,179 Y697H probably damaging Het
Wnk4 C A 11: 101,265,377 R461S probably damaging Het
Xylb T A 9: 119,364,501 L87Q probably damaging Het
Zcchc9 T A 13: 91,797,162 K101* probably null Het
Zfp503 C A 14: 21,985,637 A404S probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Pde3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Pde3a APN 6 141459738 missense probably damaging 1.00
IGL01400:Pde3a APN 6 141459228 missense probably benign 0.02
IGL01752:Pde3a APN 6 141487613 splice site probably benign
IGL01819:Pde3a APN 6 141487537 missense probably damaging 1.00
IGL02014:Pde3a APN 6 141459144 missense probably null 1.00
IGL02119:Pde3a APN 6 141459803 missense probably damaging 0.97
IGL02465:Pde3a APN 6 141249675 missense possibly damaging 0.53
IGL02677:Pde3a APN 6 141405172 splice site probably benign
IGL02961:Pde3a APN 6 141459700 nonsense probably null
IGL03034:Pde3a APN 6 141492400 splice site probably benign
IGL03142:Pde3a APN 6 141492299 missense probably benign 0.01
PIT4305001:Pde3a UTSW 6 141492310 missense probably benign 0.04
R0412:Pde3a UTSW 6 141498684 missense probably damaging 1.00
R0517:Pde3a UTSW 6 141498657 nonsense probably null
R0573:Pde3a UTSW 6 141492231 missense probably damaging 1.00
R0621:Pde3a UTSW 6 141249999 missense probably damaging 1.00
R0781:Pde3a UTSW 6 141459316 splice site probably benign
R1065:Pde3a UTSW 6 141476732 splice site probably benign
R1110:Pde3a UTSW 6 141459316 splice site probably benign
R1462:Pde3a UTSW 6 141459834 missense probably benign 0.05
R1462:Pde3a UTSW 6 141459834 missense probably benign 0.05
R1470:Pde3a UTSW 6 141466206 missense probably benign 0.41
R1470:Pde3a UTSW 6 141466206 missense probably benign 0.41
R1480:Pde3a UTSW 6 141487574 missense probably benign 0.17
R1559:Pde3a UTSW 6 141459098 missense probably damaging 1.00
R1862:Pde3a UTSW 6 141250353 missense probably damaging 1.00
R1862:Pde3a UTSW 6 141487513 missense probably damaging 1.00
R1902:Pde3a UTSW 6 141498770 missense probably benign
R1909:Pde3a UTSW 6 141250239 missense probably benign 0.00
R2048:Pde3a UTSW 6 141489006 splice site probably benign
R2144:Pde3a UTSW 6 141490111 missense probably benign 0.40
R2155:Pde3a UTSW 6 141483914 missense possibly damaging 0.70
R2208:Pde3a UTSW 6 141250347 missense probably damaging 0.97
R2405:Pde3a UTSW 6 141481242 missense probably damaging 1.00
R4592:Pde3a UTSW 6 141459216 missense probably benign 0.13
R4677:Pde3a UTSW 6 141466139 missense probably benign 0.02
R4803:Pde3a UTSW 6 141459086 missense probably damaging 1.00
R4887:Pde3a UTSW 6 141470942 missense possibly damaging 0.94
R4999:Pde3a UTSW 6 141250025 missense probably benign 0.00
R5055:Pde3a UTSW 6 141487956 nonsense probably null
R5640:Pde3a UTSW 6 141483915 missense probably damaging 0.99
R5694:Pde3a UTSW 6 141250502 missense possibly damaging 0.48
R6176:Pde3a UTSW 6 141498889 missense possibly damaging 0.96
R6394:Pde3a UTSW 6 141487511 missense probably damaging 1.00
R6692:Pde3a UTSW 6 141479346 missense probably damaging 1.00
R6968:Pde3a UTSW 6 141487932 missense probably damaging 1.00
R7137:Pde3a UTSW 6 141498746 missense probably benign 0.26
R7163:Pde3a UTSW 6 141487544 missense probably damaging 1.00
R7677:Pde3a UTSW 6 141250257 missense probably damaging 1.00
R7754:Pde3a UTSW 6 141459249 missense probably benign 0.32
R8037:Pde3a UTSW 6 141483924 missense possibly damaging 0.82
X0053:Pde3a UTSW 6 141483969 splice site probably null
X0062:Pde3a UTSW 6 141249984 missense probably damaging 1.00
Z1177:Pde3a UTSW 6 141250469 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AATGCTGGCTGGCCTCTTTAC -3'
(R):5'- TCTTTGGAAAACACACAGCCATAG -3'

Sequencing Primer
(F):5'- ACTTACTTGAGAGAGATGCAGTTG -3'
(R):5'- CAGCCATAGAAGTTACCAGGTGTTC -3'
Posted On2016-07-06