Incidental Mutation 'R5181:Sult2a4'
ID397546
Institutional Source Beutler Lab
Gene Symbol Sult2a4
Ensembl Gene ENSMUSG00000074377
Gene Namesulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 4
SynonymsGm5584
MMRRC Submission 042761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5181 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location13909676-13989607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 13988391 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 50 (I50L)
Ref Sequence ENSEMBL: ENSMUSP00000130490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108520] [ENSMUST00000165167]
Predicted Effect probably benign
Transcript: ENSMUST00000108520
AA Change: I51L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104160
Gene: ENSMUSG00000074377
AA Change: I51L

DomainStartEndE-ValueType
Pfam:Sulfotransfer_3 5 205 1.5e-10 PFAM
Pfam:Sulfotransfer_1 34 278 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165167
AA Change: I50L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000130490
Gene: ENSMUSG00000074377
AA Change: I50L

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 33 277 1.3e-82 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: This is one of seven sulfotransferase family 2A genes in a chromosome 7 A1 cluster. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,714,937 D642E probably benign Het
Anxa2 T C 9: 69,476,065 V54A probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdca2 A G 14: 67,680,165 S595P probably damaging Het
Cenpe G A 3: 135,242,303 E1208K probably damaging Het
Cfh T C 1: 140,147,646 probably benign Het
Colq T A 14: 31,557,842 H9L probably benign Het
Coq8b T C 7: 27,252,322 I403T possibly damaging Het
Dcdc2a C A 13: 25,202,364 T407K possibly damaging Het
Fam198b A T 3: 79,886,311 S29C probably benign Het
Fam49b T A 15: 63,938,677 M234L probably damaging Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Inpp5f A G 7: 128,679,831 T519A probably damaging Het
Isl2 G T 9: 55,542,277 R79L probably benign Het
Kif9 T A 9: 110,521,268 D742E probably damaging Het
Lgi2 T A 5: 52,554,450 K176M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrch4 A G 5: 137,629,403 D66G probably damaging Het
Milr1 G A 11: 106,754,980 G116D probably damaging Het
Myof T C 19: 37,932,623 D1397G possibly damaging Het
Neurod2 T C 11: 98,327,378 H320R probably benign Het
Nox3 A T 17: 3,635,286 Y562* probably null Het
Nrap G A 19: 56,345,528 H884Y possibly damaging Het
Pde3a T C 6: 141,481,255 probably null Het
Pgm2l1 G A 7: 100,261,758 C303Y probably benign Het
Phip A G 9: 82,871,190 probably benign Het
Plxna4 A G 6: 32,516,997 I228T probably damaging Het
Prdm2 A G 4: 143,134,966 S585P probably benign Het
Prpf6 T C 2: 181,649,546 I718T probably damaging Het
Rpp40 T C 13: 35,896,712 probably null Het
Skiv2l T C 17: 34,844,826 D547G probably benign Het
Slc22a22 T A 15: 57,255,123 Y264F probably benign Het
Slc5a4b A T 10: 76,060,387 L578* probably null Het
Sptan1 A T 2: 29,993,724 probably benign Het
St5 T C 7: 109,556,790 Y251C probably benign Het
Taar6 T C 10: 23,984,785 T288A possibly damaging Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmem98 T C 11: 80,819,932 V139A probably damaging Het
Triobp T C 15: 78,967,754 Y703H probably benign Het
Ttc25 G A 11: 100,549,893 D67N probably damaging Het
Ttc34 A G 4: 154,862,246 T868A probably benign Het
Ttn C T 2: 76,834,881 probably benign Het
Vipas39 A T 12: 87,239,827 W470R probably damaging Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Vmn2r111 T C 17: 22,571,020 N335S possibly damaging Het
Vmn2r70 A G 7: 85,559,179 Y697H probably damaging Het
Wnk4 C A 11: 101,265,377 R461S probably damaging Het
Xylb T A 9: 119,364,501 L87Q probably damaging Het
Zcchc9 T A 13: 91,797,162 K101* probably null Het
Zfp503 C A 14: 21,985,637 A404S probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Sult2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Sult2a4 APN 7 13984945 missense probably damaging 1.00
IGL00835:Sult2a4 APN 7 13909789 missense probably benign 0.01
IGL02078:Sult2a4 APN 7 13989544 missense probably benign 0.02
IGL02409:Sult2a4 APN 7 13984919 nonsense probably null
IGL02970:Sult2a4 APN 7 13909906 splice site probably benign
IGL03201:Sult2a4 APN 7 13931767 missense probably damaging 0.97
R0827:Sult2a4 UTSW 7 13984961 missense probably benign 0.03
R1484:Sult2a4 UTSW 7 13909801 missense probably benign
R1523:Sult2a4 UTSW 7 13909860 nonsense probably null
R1613:Sult2a4 UTSW 7 13989495 missense probably damaging 0.98
R2127:Sult2a4 UTSW 7 13915260 missense probably damaging 0.99
R2372:Sult2a4 UTSW 7 13915300 missense probably benign 0.15
R3161:Sult2a4 UTSW 7 13989471 missense probably benign 0.17
R7124:Sult2a4 UTSW 7 13988395 nonsense probably null
R8214:Sult2a4 UTSW 7 13989476 missense probably benign 0.10
X0028:Sult2a4 UTSW 7 13988241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTGGCCTTAGAACTGAAG -3'
(R):5'- TTCCATAGGCAGTGGGAATACAG -3'

Sequencing Primer
(F):5'- CCTTGGCCTTAGAACTGAAGAAAGAC -3'
(R):5'- ACTCAGTCATATATTGCAGCATGGGG -3'
Posted On2016-07-06