Mutagenetix > Incidental Mutations

Incidental Mutation 'R5181:St5'

397550

Institutional Source

Beutler Lab

Gene Symbol

St5

Ensembl Gene

ENSMUSG00000031024

Gene Name

suppression of tumorigenicity 5

Synonyms

2610305K15Rik, 2010004M01Rik

MMRRC Submission

042761-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.396) question?

Stock #

R5181 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109523911-109703605 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109556790 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 251 (Y251C)

Ref Sequence

ENSEMBL: ENSMUSP00000078264 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005] [ENSMUST00000207394] [ENSMUST00000207745] [ENSMUST00000208583]

Predicted Effect

probably benign
Transcript: ENSMUST00000077909
AA Change: Y251C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: Y251C

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000079282
AA Change: Y251C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: Y251C

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000084738

SMART Domains

Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168005

SMART Domains

Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207394

Predicted Effect

probably benign
Transcript: ENSMUST00000207745

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208557

Predicted Effect

probably benign
Transcript: ENSMUST00000208583

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208981

Meta Mutation Damage Score

0.0627

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	T	A	5: 8,714,937	D642E	probably benign	Het
Anxa2	T	C	9: 69,476,065	V54A	probably benign	Het
Ccnb1	C	G	13: 100,781,775	Q121H	possibly damaging	Het
Cdca2	A	G	14: 67,680,165	S595P	probably damaging	Het
Cenpe	G	A	3: 135,242,303	E1208K	probably damaging	Het
Cfh	T	C	1: 140,147,646		probably benign	Het
Colq	T	A	14: 31,557,842	H9L	probably benign	Het
Coq8b	T	C	7: 27,252,322	I403T	possibly damaging	Het
Dcdc2a	C	A	13: 25,202,364	T407K	possibly damaging	Het
Fam198b	A	T	3: 79,886,311	S29C	probably benign	Het
Fam49b	T	A	15: 63,938,677	M234L	probably damaging	Het
Grhl3	T	A	4: 135,559,104	K89*	probably null	Het
Inpp5f	A	G	7: 128,679,831	T519A	probably damaging	Het
Isl2	G	T	9: 55,542,277	R79L	probably benign	Het
Kif9	T	A	9: 110,521,268	D742E	probably damaging	Het
Lgi2	T	A	5: 52,554,450	K176M	probably damaging	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lrch4	A	G	5: 137,629,403	D66G	probably damaging	Het
Milr1	G	A	11: 106,754,980	G116D	probably damaging	Het
Myof	T	C	19: 37,932,623	D1397G	possibly damaging	Het
Neurod2	T	C	11: 98,327,378	H320R	probably benign	Het
Nox3	A	T	17: 3,635,286	Y562*	probably null	Het
Nrap	G	A	19: 56,345,528	H884Y	possibly damaging	Het
Pde3a	T	C	6: 141,481,255		probably null	Het
Pgm2l1	G	A	7: 100,261,758	C303Y	probably benign	Het
Phip	A	G	9: 82,871,190		probably benign	Het
Plxna4	A	G	6: 32,516,997	I228T	probably damaging	Het
Prdm2	A	G	4: 143,134,966	S585P	probably benign	Het
Prpf6	T	C	2: 181,649,546	I718T	probably damaging	Het
Rpp40	T	C	13: 35,896,712		probably null	Het
Skiv2l	T	C	17: 34,844,826	D547G	probably benign	Het
Slc22a22	T	A	15: 57,255,123	Y264F	probably benign	Het
Slc5a4b	A	T	10: 76,060,387	L578*	probably null	Het
Sptan1	A	T	2: 29,993,724		probably benign	Het
Sult2a4	T	G	7: 13,988,391	I50L	probably benign	Het
Taar6	T	C	10: 23,984,785	T288A	possibly damaging	Het
Tmem71	C	T	15: 66,555,214	S44N	probably benign	Het
Tmem98	T	C	11: 80,819,932	V139A	probably damaging	Het
Triobp	T	C	15: 78,967,754	Y703H	probably benign	Het
Ttc25	G	A	11: 100,549,893	D67N	probably damaging	Het
Ttc34	A	G	4: 154,862,246	T868A	probably benign	Het
Ttn	C	T	2: 76,834,881		probably benign	Het
Vipas39	A	T	12: 87,239,827	W470R	probably damaging	Het
Vmn2r102	T	C	17: 19,676,741	Y117H	probably benign	Het
Vmn2r111	T	C	17: 22,571,020	N335S	possibly damaging	Het
Vmn2r70	A	G	7: 85,559,179	Y697H	probably damaging	Het
Wnk4	C	A	11: 101,265,377	R461S	probably damaging	Het
Xylb	T	A	9: 119,364,501	L87Q	probably damaging	Het
Zcchc9	T	A	13: 91,797,162	K101*	probably null	Het
Zfp503	C	A	14: 21,985,637	A404S	probably benign	Het
Zhx1	C	G	15: 58,054,074	G259R	probably damaging	Het

Other mutations in St5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:St5	APN	7	109527708	missense	possibly damaging	0.71
IGL01132:St5	APN	7	109570005	unclassified	probably null
IGL01288:St5	APN	7	109539822	missense	probably damaging	0.96
IGL01645:St5	APN	7	109527634	nonsense	probably null
IGL01714:St5	APN	7	109570062	missense	probably damaging	0.99
IGL02021:St5	APN	7	109557372	missense	probably damaging	1.00
IGL02302:St5	APN	7	109525331	missense	probably damaging	1.00
IGL02496:St5	APN	7	109556235	missense	possibly damaging	0.83
IGL02795:St5	APN	7	109556364	missense	probably damaging	1.00
FR4340:St5	UTSW	7	109556921	unclassified	probably benign
FR4737:St5	UTSW	7	109556921	unclassified	probably benign
PIT4466001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4469001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4472001:St5	UTSW	7	109531130	missense	probably damaging	1.00
R0024:St5	UTSW	7	109524659	missense	probably damaging	1.00
R0124:St5	UTSW	7	109542511	missense	possibly damaging	0.66
R0125:St5	UTSW	7	109556338	missense	probably benign	0.19
R0365:St5	UTSW	7	109538949	missense	probably damaging	1.00
R0491:St5	UTSW	7	109557204	missense	probably benign	0.45
R0534:St5	UTSW	7	109541428	missense	probably damaging	1.00
R0662:St5	UTSW	7	109557426	missense	probably damaging	1.00
R0743:St5	UTSW	7	109557345	missense	probably damaging	1.00
R0772:St5	UTSW	7	109542320	splice site	probably null
R0774:St5	UTSW	7	109542320	splice site	probably null
R0787:St5	UTSW	7	109525620	missense	possibly damaging	0.94
R0884:St5	UTSW	7	109557345	missense	probably damaging	1.00
R1518:St5	UTSW	7	109557355	missense	probably damaging	1.00
R1908:St5	UTSW	7	109525326	nonsense	probably null
R1909:St5	UTSW	7	109525326	nonsense	probably null
R2232:St5	UTSW	7	109557207	missense	probably benign
R2358:St5	UTSW	7	109556446	missense	probably benign	0.01
R2847:St5	UTSW	7	109525337	missense	probably damaging	1.00
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2873:St5	UTSW	7	109557430	missense	probably benign	0.01
R2874:St5	UTSW	7	109557430	missense	probably benign	0.01
R4534:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4536:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4559:St5	UTSW	7	109525578	missense	probably damaging	1.00
R4798:St5	UTSW	7	109557033	missense	probably damaging	0.99
R4846:St5	UTSW	7	109556836	nonsense	probably null
R5110:St5	UTSW	7	109542490	missense	probably benign	0.02
R5268:St5	UTSW	7	109557312	missense	probably benign
R5403:St5	UTSW	7	109556905	missense	probably damaging	1.00
R5836:St5	UTSW	7	109541345	missense	possibly damaging	0.78
R5932:St5	UTSW	7	109570016	missense	probably damaging	1.00
R5937:St5	UTSW	7	109557271	missense	possibly damaging	0.86
R6180:St5	UTSW	7	109556888	missense	probably benign	0.11
R6741:St5	UTSW	7	109545097	missense	possibly damaging	0.95
R6781:St5	UTSW	7	109525304	missense	possibly damaging	0.83
R7086:St5	UTSW	7	109525574	missense	probably damaging	1.00
R7466:St5	UTSW	7	109525346	missense	probably damaging	1.00
R7644:St5	UTSW	7	109556793	nonsense	probably null
RF062:St5	UTSW	7	109556946	unclassified	probably benign
X0067:St5	UTSW	7	109556240	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGTCTACACTGTAGCAGCTG -3'
(R):5'- ACCCAGGATGAGTCTGTGTG -3'

Sequencing Primer
(F):5'- GCTAGGGAGCTGGGGGAG -3'
(R):5'- CCAGGATGAGTCTGTGTGGAGAG -3'

Posted On

2016-07-06