Incidental Mutation 'R5181:Xylb'
ID397556
Institutional Source Beutler Lab
Gene Symbol Xylb
Ensembl Gene ENSMUSG00000035769
Gene Namexylulokinase homolog (H. influenzae)
Synonyms
MMRRC Submission 042761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5181 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119357381-119393797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119364501 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 87 (L87Q)
Ref Sequence ENSEMBL: ENSMUSP00000047254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039610] [ENSMUST00000170400] [ENSMUST00000215822] [ENSMUST00000216838]
Predicted Effect probably damaging
Transcript: ENSMUST00000039610
AA Change: L87Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047254
Gene: ENSMUSG00000035769
AA Change: L87Q

DomainStartEndE-ValueType
low complexity region 123 142 N/A INTRINSIC
Pfam:FGGY_N 144 302 3.9e-15 PFAM
Pfam:FGGY_C 310 496 2.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215305
Predicted Effect unknown
Transcript: ENSMUST00000215822
AA Change: W64R
Predicted Effect unknown
Transcript: ENSMUST00000216838
AA Change: W64R
Meta Mutation Damage Score 0.7687 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares 22% sequence identity with Hemophilus influenzae xylulokinase, and even higher identity to other gene products in C.elegans (45%) and yeast (31-35%), which are thought to belong to a family of enzymes that include fucokinase, gluconokinase, glycerokinase and xylulokinase. These proteins play important roles in energy metabolism. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,714,937 D642E probably benign Het
Anxa2 T C 9: 69,476,065 V54A probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdca2 A G 14: 67,680,165 S595P probably damaging Het
Cenpe G A 3: 135,242,303 E1208K probably damaging Het
Cfh T C 1: 140,147,646 probably benign Het
Colq T A 14: 31,557,842 H9L probably benign Het
Coq8b T C 7: 27,252,322 I403T possibly damaging Het
Dcdc2a C A 13: 25,202,364 T407K possibly damaging Het
Fam198b A T 3: 79,886,311 S29C probably benign Het
Fam49b T A 15: 63,938,677 M234L probably damaging Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Inpp5f A G 7: 128,679,831 T519A probably damaging Het
Isl2 G T 9: 55,542,277 R79L probably benign Het
Kif9 T A 9: 110,521,268 D742E probably damaging Het
Lgi2 T A 5: 52,554,450 K176M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrch4 A G 5: 137,629,403 D66G probably damaging Het
Milr1 G A 11: 106,754,980 G116D probably damaging Het
Myof T C 19: 37,932,623 D1397G possibly damaging Het
Neurod2 T C 11: 98,327,378 H320R probably benign Het
Nox3 A T 17: 3,635,286 Y562* probably null Het
Nrap G A 19: 56,345,528 H884Y possibly damaging Het
Pde3a T C 6: 141,481,255 probably null Het
Pgm2l1 G A 7: 100,261,758 C303Y probably benign Het
Phip A G 9: 82,871,190 probably benign Het
Plxna4 A G 6: 32,516,997 I228T probably damaging Het
Prdm2 A G 4: 143,134,966 S585P probably benign Het
Prpf6 T C 2: 181,649,546 I718T probably damaging Het
Rpp40 T C 13: 35,896,712 probably null Het
Skiv2l T C 17: 34,844,826 D547G probably benign Het
Slc22a22 T A 15: 57,255,123 Y264F probably benign Het
Slc5a4b A T 10: 76,060,387 L578* probably null Het
Sptan1 A T 2: 29,993,724 probably benign Het
St5 T C 7: 109,556,790 Y251C probably benign Het
Sult2a4 T G 7: 13,988,391 I50L probably benign Het
Taar6 T C 10: 23,984,785 T288A possibly damaging Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmem98 T C 11: 80,819,932 V139A probably damaging Het
Triobp T C 15: 78,967,754 Y703H probably benign Het
Ttc25 G A 11: 100,549,893 D67N probably damaging Het
Ttc34 A G 4: 154,862,246 T868A probably benign Het
Ttn C T 2: 76,834,881 probably benign Het
Vipas39 A T 12: 87,239,827 W470R probably damaging Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Vmn2r111 T C 17: 22,571,020 N335S possibly damaging Het
Vmn2r70 A G 7: 85,559,179 Y697H probably damaging Het
Wnk4 C A 11: 101,265,377 R461S probably damaging Het
Zcchc9 T A 13: 91,797,162 K101* probably null Het
Zfp503 C A 14: 21,985,637 A404S probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Xylb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Xylb APN 9 119390483 nonsense probably null
R0330:Xylb UTSW 9 119381587 missense probably damaging 0.98
R0959:Xylb UTSW 9 119380025 missense possibly damaging 0.85
R1127:Xylb UTSW 9 119383377 missense probably damaging 0.99
R1401:Xylb UTSW 9 119368067 splice site probably benign
R1417:Xylb UTSW 9 119364540 missense probably benign 0.04
R2315:Xylb UTSW 9 119359269 missense probably benign 0.22
R2322:Xylb UTSW 9 119388747 missense possibly damaging 0.95
R3884:Xylb UTSW 9 119380687 missense probably damaging 1.00
R4367:Xylb UTSW 9 119388715 missense probably benign 0.10
R4463:Xylb UTSW 9 119386367 missense probably benign 0.00
R4750:Xylb UTSW 9 119359313 nonsense probably null
R5568:Xylb UTSW 9 119361132 missense probably benign 0.43
R6104:Xylb UTSW 9 119364507 makesense probably null
R6171:Xylb UTSW 9 119381591 missense probably damaging 1.00
R6642:Xylb UTSW 9 119367493 missense probably damaging 1.00
R6643:Xylb UTSW 9 119367493 missense probably damaging 1.00
R6836:Xylb UTSW 9 119391754 missense probably damaging 1.00
R7121:Xylb UTSW 9 119382292 missense probably benign 0.00
R7496:Xylb UTSW 9 119391816 makesense probably null
R7776:Xylb UTSW 9 119380700 critical splice donor site probably null
R7908:Xylb UTSW 9 119381545 missense probably benign 0.00
R7989:Xylb UTSW 9 119381545 missense probably benign 0.00
R8025:Xylb UTSW 9 119381503 missense probably damaging 0.99
Z1088:Xylb UTSW 9 119381614 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGATGCCTGCTTGCTTAATCAG -3'
(R):5'- TGTCGCTACCAAAGAAATGTGTAC -3'

Sequencing Primer
(F):5'- GCTTAATCAGCTATCCCTGCACAG -3'
(R):5'- GTGTACTTAAGTTCAAGGCCCAC -3'
Posted On2016-07-06