Incidental Mutation 'R5181:Ccnb1'
ID397566
Institutional Source Beutler Lab
Gene Symbol Ccnb1
Ensembl Gene ENSMUSG00000041431
Gene Namecyclin B1
SynonymsCcnb1-rs13, Cycb-4
MMRRC Submission 042761-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5181 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100778650-100786570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 100781775 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 121 (Q121H)
Ref Sequence ENSEMBL: ENSMUSP00000088841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072119] [ENSMUST00000091295] [ENSMUST00000174038]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072119
AA Change: Q182H

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071989
Gene: ENSMUSG00000041431
AA Change: Q182H

DomainStartEndE-ValueType
low complexity region 80 110 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
CYCLIN 204 288 3.88e-26 SMART
Cyclin_C 297 415 4.18e-37 SMART
CYCLIN 301 382 3.65e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000091295
AA Change: Q121H

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088841
Gene: ENSMUSG00000041431
AA Change: Q121H

DomainStartEndE-ValueType
low complexity region 80 110 N/A INTRINSIC
CYCLIN 143 227 3.88e-26 SMART
Cyclin_C 236 354 4.18e-37 SMART
CYCLIN 240 321 3.65e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147790
Predicted Effect probably benign
Transcript: ENSMUST00000174038
AA Change: Q182H

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133962
Gene: ENSMUSG00000041431
AA Change: Q182H

DomainStartEndE-ValueType
low complexity region 80 110 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
CYCLIN 204 288 3.88e-26 SMART
Cyclin_C 297 378 3.18e-10 SMART
CYCLIN 301 384 8.4e-13 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene is embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,714,937 D642E probably benign Het
Anxa2 T C 9: 69,476,065 V54A probably benign Het
Cdca2 A G 14: 67,680,165 S595P probably damaging Het
Cenpe G A 3: 135,242,303 E1208K probably damaging Het
Cfh T C 1: 140,147,646 probably benign Het
Colq T A 14: 31,557,842 H9L probably benign Het
Coq8b T C 7: 27,252,322 I403T possibly damaging Het
Dcdc2a C A 13: 25,202,364 T407K possibly damaging Het
Fam198b A T 3: 79,886,311 S29C probably benign Het
Fam49b T A 15: 63,938,677 M234L probably damaging Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Inpp5f A G 7: 128,679,831 T519A probably damaging Het
Isl2 G T 9: 55,542,277 R79L probably benign Het
Kif9 T A 9: 110,521,268 D742E probably damaging Het
Lgi2 T A 5: 52,554,450 K176M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrch4 A G 5: 137,629,403 D66G probably damaging Het
Milr1 G A 11: 106,754,980 G116D probably damaging Het
Myof T C 19: 37,932,623 D1397G possibly damaging Het
Neurod2 T C 11: 98,327,378 H320R probably benign Het
Nox3 A T 17: 3,635,286 Y562* probably null Het
Nrap G A 19: 56,345,528 H884Y possibly damaging Het
Pde3a T C 6: 141,481,255 probably null Het
Pgm2l1 G A 7: 100,261,758 C303Y probably benign Het
Phip A G 9: 82,871,190 probably benign Het
Plxna4 A G 6: 32,516,997 I228T probably damaging Het
Prdm2 A G 4: 143,134,966 S585P probably benign Het
Prpf6 T C 2: 181,649,546 I718T probably damaging Het
Rpp40 T C 13: 35,896,712 probably null Het
Skiv2l T C 17: 34,844,826 D547G probably benign Het
Slc22a22 T A 15: 57,255,123 Y264F probably benign Het
Slc5a4b A T 10: 76,060,387 L578* probably null Het
Sptan1 A T 2: 29,993,724 probably benign Het
St5 T C 7: 109,556,790 Y251C probably benign Het
Sult2a4 T G 7: 13,988,391 I50L probably benign Het
Taar6 T C 10: 23,984,785 T288A possibly damaging Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmem98 T C 11: 80,819,932 V139A probably damaging Het
Triobp T C 15: 78,967,754 Y703H probably benign Het
Ttc25 G A 11: 100,549,893 D67N probably damaging Het
Ttc34 A G 4: 154,862,246 T868A probably benign Het
Ttn C T 2: 76,834,881 probably benign Het
Vipas39 A T 12: 87,239,827 W470R probably damaging Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Vmn2r111 T C 17: 22,571,020 N335S possibly damaging Het
Vmn2r70 A G 7: 85,559,179 Y697H probably damaging Het
Wnk4 C A 11: 101,265,377 R461S probably damaging Het
Xylb T A 9: 119,364,501 L87Q probably damaging Het
Zcchc9 T A 13: 91,797,162 K101* probably null Het
Zfp503 C A 14: 21,985,637 A404S probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Ccnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Ccnb1 APN 13 100785911 splice site probably benign
IGL01775:Ccnb1 APN 13 100783509 missense probably benign 0.36
IGL01874:Ccnb1 APN 13 100783493 missense probably damaging 1.00
IGL02108:Ccnb1 APN 13 100781157 critical splice donor site probably null
IGL02170:Ccnb1 APN 13 100783486 nonsense probably null
IGL02372:Ccnb1 APN 13 100781316 missense probably damaging 1.00
IGL02755:Ccnb1 APN 13 100781660 missense possibly damaging 0.89
IGL03142:Ccnb1 APN 13 100783531 missense probably damaging 1.00
R0025:Ccnb1 UTSW 13 100779781 missense probably damaging 1.00
R0499:Ccnb1 UTSW 13 100780134 critical splice acceptor site probably null
R2249:Ccnb1 UTSW 13 100781319 missense possibly damaging 0.79
R3108:Ccnb1 UTSW 13 100781624 critical splice donor site probably null
R4934:Ccnb1 UTSW 13 100781701 missense possibly damaging 0.49
R5126:Ccnb1 UTSW 13 100781775 missense possibly damaging 0.88
R5127:Ccnb1 UTSW 13 100781775 missense possibly damaging 0.88
R5180:Ccnb1 UTSW 13 100781775 missense possibly damaging 0.88
R5325:Ccnb1 UTSW 13 100781775 missense possibly damaging 0.88
R7024:Ccnb1 UTSW 13 100786380 critical splice donor site probably null
R7583:Ccnb1 UTSW 13 100779754 missense probably benign 0.06
R7632:Ccnb1 UTSW 13 100781701 missense probably benign 0.32
R7833:Ccnb1 UTSW 13 100781351 missense probably damaging 1.00
R7916:Ccnb1 UTSW 13 100781351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATAGAGCTACAACTGGATAACTC -3'
(R):5'- GAGCTGCAATAGTTCTGGCTAAC -3'

Sequencing Primer
(F):5'- CTCAATTACTGAATGACACATACCTG -3'
(R):5'- CCAGATGGTCGCTCTGTCAAC -3'
Posted On2016-07-06