Incidental Mutation 'R5181:Slc22a22'
ID397570
Institutional Source Beutler Lab
Gene Symbol Slc22a22
Ensembl Gene ENSMUSG00000022366
Gene Namesolute carrier family 22 (organic cation transporter), member 22
SynonymsBC026439, OAT-PG
MMRRC Submission 042761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5181 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location57243767-57477625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57255123 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 264 (Y264F)
Ref Sequence ENSEMBL: ENSMUSP00000105825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022995] [ENSMUST00000110196] [ENSMUST00000137764]
Predicted Effect probably benign
Transcript: ENSMUST00000022995
AA Change: Y264F

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022995
Gene: ENSMUSG00000022366
AA Change: Y264F

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:MFS_1 117 483 1.2e-26 PFAM
Pfam:Sugar_tr 144 447 1.3e-20 PFAM
Pfam:Sugar_tr 393 553 3.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110196
AA Change: Y264F

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105825
Gene: ENSMUSG00000022366
AA Change: Y264F

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:MFS_1 116 483 1.4e-26 PFAM
Pfam:Sugar_tr 145 426 1e-19 PFAM
Pfam:Sugar_tr 391 553 2.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137764
SMART Domains Protein: ENSMUSP00000123667
Gene: ENSMUSG00000022366

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,714,937 D642E probably benign Het
Anxa2 T C 9: 69,476,065 V54A probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdca2 A G 14: 67,680,165 S595P probably damaging Het
Cenpe G A 3: 135,242,303 E1208K probably damaging Het
Cfh T C 1: 140,147,646 probably benign Het
Colq T A 14: 31,557,842 H9L probably benign Het
Coq8b T C 7: 27,252,322 I403T possibly damaging Het
Dcdc2a C A 13: 25,202,364 T407K possibly damaging Het
Fam198b A T 3: 79,886,311 S29C probably benign Het
Fam49b T A 15: 63,938,677 M234L probably damaging Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Inpp5f A G 7: 128,679,831 T519A probably damaging Het
Isl2 G T 9: 55,542,277 R79L probably benign Het
Kif9 T A 9: 110,521,268 D742E probably damaging Het
Lgi2 T A 5: 52,554,450 K176M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrch4 A G 5: 137,629,403 D66G probably damaging Het
Milr1 G A 11: 106,754,980 G116D probably damaging Het
Myof T C 19: 37,932,623 D1397G possibly damaging Het
Neurod2 T C 11: 98,327,378 H320R probably benign Het
Nox3 A T 17: 3,635,286 Y562* probably null Het
Nrap G A 19: 56,345,528 H884Y possibly damaging Het
Pde3a T C 6: 141,481,255 probably null Het
Pgm2l1 G A 7: 100,261,758 C303Y probably benign Het
Phip A G 9: 82,871,190 probably benign Het
Plxna4 A G 6: 32,516,997 I228T probably damaging Het
Prdm2 A G 4: 143,134,966 S585P probably benign Het
Prpf6 T C 2: 181,649,546 I718T probably damaging Het
Rpp40 T C 13: 35,896,712 probably null Het
Skiv2l T C 17: 34,844,826 D547G probably benign Het
Slc5a4b A T 10: 76,060,387 L578* probably null Het
Sptan1 A T 2: 29,993,724 probably benign Het
St5 T C 7: 109,556,790 Y251C probably benign Het
Sult2a4 T G 7: 13,988,391 I50L probably benign Het
Taar6 T C 10: 23,984,785 T288A possibly damaging Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmem98 T C 11: 80,819,932 V139A probably damaging Het
Triobp T C 15: 78,967,754 Y703H probably benign Het
Ttc25 G A 11: 100,549,893 D67N probably damaging Het
Ttc34 A G 4: 154,862,246 T868A probably benign Het
Ttn C T 2: 76,834,881 probably benign Het
Vipas39 A T 12: 87,239,827 W470R probably damaging Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Vmn2r111 T C 17: 22,571,020 N335S possibly damaging Het
Vmn2r70 A G 7: 85,559,179 Y697H probably damaging Het
Wnk4 C A 11: 101,265,377 R461S probably damaging Het
Xylb T A 9: 119,364,501 L87Q probably damaging Het
Zcchc9 T A 13: 91,797,162 K101* probably null Het
Zfp503 C A 14: 21,985,637 A404S probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Slc22a22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Slc22a22 APN 15 57254278 missense probably damaging 1.00
IGL01140:Slc22a22 APN 15 57263338 missense probably damaging 1.00
IGL02350:Slc22a22 APN 15 57247448 missense probably benign 0.16
IGL02357:Slc22a22 APN 15 57247448 missense probably benign 0.16
IGL03115:Slc22a22 APN 15 57263274 missense probably damaging 1.00
IGL03244:Slc22a22 APN 15 57249552 splice site probably benign
IGL03384:Slc22a22 APN 15 57254216 missense probably benign 0.01
R0371:Slc22a22 UTSW 15 57249735 missense possibly damaging 0.82
R0501:Slc22a22 UTSW 15 57249650 missense probably benign 0.16
R0684:Slc22a22 UTSW 15 57263362 missense probably benign 0.04
R0722:Slc22a22 UTSW 15 57256553 unclassified probably null
R1240:Slc22a22 UTSW 15 57250872 missense probably benign 0.02
R1472:Slc22a22 UTSW 15 57247520 missense probably benign 0.03
R2040:Slc22a22 UTSW 15 57247540 nonsense probably null
R2125:Slc22a22 UTSW 15 57254240 missense probably damaging 1.00
R3707:Slc22a22 UTSW 15 57250973 missense probably damaging 1.00
R3921:Slc22a22 UTSW 15 57256544 missense probably benign 0.07
R4184:Slc22a22 UTSW 15 57256566 nonsense probably null
R4561:Slc22a22 UTSW 15 57263385 missense probably damaging 1.00
R4626:Slc22a22 UTSW 15 57263338 missense probably damaging 1.00
R4887:Slc22a22 UTSW 15 57249752 missense probably benign 0.20
R5486:Slc22a22 UTSW 15 57263451 missense probably damaging 0.97
R5621:Slc22a22 UTSW 15 57259151 missense probably benign 0.02
R5812:Slc22a22 UTSW 15 57256473 critical splice donor site probably null
R5958:Slc22a22 UTSW 15 57263536 missense possibly damaging 0.95
R6517:Slc22a22 UTSW 15 57250969 missense probably benign 0.28
R6555:Slc22a22 UTSW 15 57259131 missense probably benign 0.08
R6724:Slc22a22 UTSW 15 57247532 missense probably damaging 1.00
R6744:Slc22a22 UTSW 15 57254272 missense possibly damaging 0.46
R7078:Slc22a22 UTSW 15 57263480 missense probably benign 0.01
R7085:Slc22a22 UTSW 15 57249649 missense probably benign 0.00
R7263:Slc22a22 UTSW 15 57249711 missense probably benign
R7335:Slc22a22 UTSW 15 57263375 missense probably benign 0.19
R7859:Slc22a22 UTSW 15 57250952 missense probably benign 0.02
R7871:Slc22a22 UTSW 15 57263355 missense possibly damaging 0.86
R7942:Slc22a22 UTSW 15 57250952 missense probably benign 0.02
R7954:Slc22a22 UTSW 15 57263355 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTAAGGCTGTTAACGTTTACTTCCTG -3'
(R):5'- TCCTTAAGTCACTATTGGTCATGGC -3'

Sequencing Primer
(F):5'- AACGTTTACTTCCTGCATGTTATAC -3'
(R):5'- TGGTCATGGCAATAAAACACCTG -3'
Posted On2016-07-06