Incidental Mutation 'R5181:Zhx1'
ID397571
Institutional Source Beutler Lab
Gene Symbol Zhx1
Ensembl Gene ENSMUSG00000022361
Gene Namezinc fingers and homeoboxes 1
Synonyms
MMRRC Submission 042761-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5181 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location58047003-58076541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 58054074 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 259 (G259R)
Ref Sequence ENSEMBL: ENSMUSP00000135230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070143] [ENSMUST00000110168] [ENSMUST00000175805] [ENSMUST00000176076] [ENSMUST00000176935] [ENSMUST00000177176] [ENSMUST00000177276] [ENSMUST00000177504]
Predicted Effect probably damaging
Transcript: ENSMUST00000070143
AA Change: G259R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066201
Gene: ENSMUSG00000022361
AA Change: G259R

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110168
AA Change: G259R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105797
Gene: ENSMUSG00000022361
AA Change: G259R

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175805
AA Change: G259R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134844
Gene: ENSMUSG00000022361
AA Change: G259R

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176270
Predicted Effect probably benign
Transcript: ENSMUST00000176935
SMART Domains Protein: ENSMUSP00000134752
Gene: ENSMUSG00000022362

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177176
Predicted Effect probably damaging
Transcript: ENSMUST00000177276
AA Change: G259R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135230
Gene: ENSMUSG00000022361
AA Change: G259R

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 623 2.77e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177504
SMART Domains Protein: ENSMUSP00000135111
Gene: ENSMUSG00000022362

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Meta Mutation Damage Score 0.1460 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 1 of this gene family. In addition to forming homodimers, this protein heterodimerizes with members 2 and 3 of the zinc fingers and homeoboxes family. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream chromosome 8 open reading frame 76 (C8orf76) gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,714,937 D642E probably benign Het
Anxa2 T C 9: 69,476,065 V54A probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdca2 A G 14: 67,680,165 S595P probably damaging Het
Cenpe G A 3: 135,242,303 E1208K probably damaging Het
Cfh T C 1: 140,147,646 probably benign Het
Colq T A 14: 31,557,842 H9L probably benign Het
Coq8b T C 7: 27,252,322 I403T possibly damaging Het
Dcdc2a C A 13: 25,202,364 T407K possibly damaging Het
Fam198b A T 3: 79,886,311 S29C probably benign Het
Fam49b T A 15: 63,938,677 M234L probably damaging Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Inpp5f A G 7: 128,679,831 T519A probably damaging Het
Isl2 G T 9: 55,542,277 R79L probably benign Het
Kif9 T A 9: 110,521,268 D742E probably damaging Het
Lgi2 T A 5: 52,554,450 K176M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrch4 A G 5: 137,629,403 D66G probably damaging Het
Milr1 G A 11: 106,754,980 G116D probably damaging Het
Myof T C 19: 37,932,623 D1397G possibly damaging Het
Neurod2 T C 11: 98,327,378 H320R probably benign Het
Nox3 A T 17: 3,635,286 Y562* probably null Het
Nrap G A 19: 56,345,528 H884Y possibly damaging Het
Pde3a T C 6: 141,481,255 probably null Het
Pgm2l1 G A 7: 100,261,758 C303Y probably benign Het
Phip A G 9: 82,871,190 probably benign Het
Plxna4 A G 6: 32,516,997 I228T probably damaging Het
Prdm2 A G 4: 143,134,966 S585P probably benign Het
Prpf6 T C 2: 181,649,546 I718T probably damaging Het
Rpp40 T C 13: 35,896,712 probably null Het
Skiv2l T C 17: 34,844,826 D547G probably benign Het
Slc22a22 T A 15: 57,255,123 Y264F probably benign Het
Slc5a4b A T 10: 76,060,387 L578* probably null Het
Sptan1 A T 2: 29,993,724 probably benign Het
St5 T C 7: 109,556,790 Y251C probably benign Het
Sult2a4 T G 7: 13,988,391 I50L probably benign Het
Taar6 T C 10: 23,984,785 T288A possibly damaging Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmem98 T C 11: 80,819,932 V139A probably damaging Het
Triobp T C 15: 78,967,754 Y703H probably benign Het
Ttc25 G A 11: 100,549,893 D67N probably damaging Het
Ttc34 A G 4: 154,862,246 T868A probably benign Het
Ttn C T 2: 76,834,881 probably benign Het
Vipas39 A T 12: 87,239,827 W470R probably damaging Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Vmn2r111 T C 17: 22,571,020 N335S possibly damaging Het
Vmn2r70 A G 7: 85,559,179 Y697H probably damaging Het
Wnk4 C A 11: 101,265,377 R461S probably damaging Het
Xylb T A 9: 119,364,501 L87Q probably damaging Het
Zcchc9 T A 13: 91,797,162 K101* probably null Het
Zfp503 C A 14: 21,985,637 A404S probably benign Het
Other mutations in Zhx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Zhx1 APN 15 58053315 missense probably damaging 1.00
IGL00819:Zhx1 APN 15 58054694 missense probably benign 0.00
IGL01025:Zhx1 APN 15 58054679 missense probably benign 0.32
IGL01867:Zhx1 APN 15 58054445 missense probably damaging 1.00
IGL02000:Zhx1 APN 15 58054287 missense probably damaging 1.00
IGL02093:Zhx1 APN 15 58052868 missense probably benign
IGL02156:Zhx1 APN 15 58054049 missense possibly damaging 0.89
IGL02399:Zhx1 APN 15 58053741 missense probably damaging 1.00
IGL02479:Zhx1 APN 15 58054371 missense probably damaging 1.00
R0667:Zhx1 UTSW 15 58053165 missense possibly damaging 0.63
R1502:Zhx1 UTSW 15 58054596 missense probably damaging 1.00
R2923:Zhx1 UTSW 15 58053681 missense probably damaging 0.99
R3039:Zhx1 UTSW 15 58053251 missense possibly damaging 0.91
R3401:Zhx1 UTSW 15 58054349 missense probably benign 0.13
R3403:Zhx1 UTSW 15 58054349 missense probably benign 0.13
R3979:Zhx1 UTSW 15 58053240 missense probably benign 0.14
R4086:Zhx1 UTSW 15 58052921 missense possibly damaging 0.93
R5013:Zhx1 UTSW 15 58054142 missense possibly damaging 0.61
R5124:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5125:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5180:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5186:Zhx1 UTSW 15 58052423 missense probably damaging 0.99
R5187:Zhx1 UTSW 15 58052423 missense probably damaging 0.99
R5408:Zhx1 UTSW 15 58052423 missense probably damaging 0.99
R5490:Zhx1 UTSW 15 58053299 missense probably damaging 1.00
R5629:Zhx1 UTSW 15 58054811 missense probably damaging 1.00
R6314:Zhx1 UTSW 15 58054002 missense probably benign 0.01
R6768:Zhx1 UTSW 15 58054103 missense probably benign 0.27
R7081:Zhx1 UTSW 15 58054338 missense probably benign 0.00
R7211:Zhx1 UTSW 15 58053251 missense possibly damaging 0.91
R7219:Zhx1 UTSW 15 58054337 missense probably benign
R7232:Zhx1 UTSW 15 58053069 missense probably benign 0.04
R7275:Zhx1 UTSW 15 58054362 missense probably benign
R7287:Zhx1 UTSW 15 58053296 missense probably damaging 1.00
R7369:Zhx1 UTSW 15 58053300 missense probably damaging 1.00
R7381:Zhx1 UTSW 15 58053165 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ACGTTGGGCTGAAAACCAGATC -3'
(R):5'- CTGAGGGCACTTCTGAAGAG -3'

Sequencing Primer
(F):5'- GGGCTGAAAACCAGATCTTGATTTG -3'
(R):5'- CTGAGGGCACTTCTGAAGAGAAAGAG -3'
Posted On2016-07-06