Incidental Mutation 'R5181:Fam49b'
ID397572
Institutional Source Beutler Lab
Gene Symbol Fam49b
Ensembl Gene ENSMUSG00000022378
Gene Namefamily with sequence similarity 49, member B
Synonyms
MMRRC Submission 042761-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5181 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location63929097-64060478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63938677 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 234 (M234L)
Ref Sequence ENSEMBL: ENSMUSP00000154320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063838] [ENSMUST00000164532] [ENSMUST00000227024] [ENSMUST00000228226] [ENSMUST00000228908]
Predicted Effect probably damaging
Transcript: ENSMUST00000063838
AA Change: M234L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066359
Gene: ENSMUSG00000022378
AA Change: M234L

DomainStartEndE-ValueType
Pfam:DUF1394 16 320 1e-179 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164532
AA Change: M234L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132486
Gene: ENSMUSG00000022378
AA Change: M234L

DomainStartEndE-ValueType
Pfam:DUF1394 18 320 3e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227024
Predicted Effect probably damaging
Transcript: ENSMUST00000228226
AA Change: M234L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000228908
Meta Mutation Damage Score 0.6308 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,714,937 D642E probably benign Het
Anxa2 T C 9: 69,476,065 V54A probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdca2 A G 14: 67,680,165 S595P probably damaging Het
Cenpe G A 3: 135,242,303 E1208K probably damaging Het
Cfh T C 1: 140,147,646 probably benign Het
Colq T A 14: 31,557,842 H9L probably benign Het
Coq8b T C 7: 27,252,322 I403T possibly damaging Het
Dcdc2a C A 13: 25,202,364 T407K possibly damaging Het
Fam198b A T 3: 79,886,311 S29C probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Inpp5f A G 7: 128,679,831 T519A probably damaging Het
Isl2 G T 9: 55,542,277 R79L probably benign Het
Kif9 T A 9: 110,521,268 D742E probably damaging Het
Lgi2 T A 5: 52,554,450 K176M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrch4 A G 5: 137,629,403 D66G probably damaging Het
Milr1 G A 11: 106,754,980 G116D probably damaging Het
Myof T C 19: 37,932,623 D1397G possibly damaging Het
Neurod2 T C 11: 98,327,378 H320R probably benign Het
Nox3 A T 17: 3,635,286 Y562* probably null Het
Nrap G A 19: 56,345,528 H884Y possibly damaging Het
Pde3a T C 6: 141,481,255 probably null Het
Pgm2l1 G A 7: 100,261,758 C303Y probably benign Het
Phip A G 9: 82,871,190 probably benign Het
Plxna4 A G 6: 32,516,997 I228T probably damaging Het
Prdm2 A G 4: 143,134,966 S585P probably benign Het
Prpf6 T C 2: 181,649,546 I718T probably damaging Het
Rpp40 T C 13: 35,896,712 probably null Het
Skiv2l T C 17: 34,844,826 D547G probably benign Het
Slc22a22 T A 15: 57,255,123 Y264F probably benign Het
Slc5a4b A T 10: 76,060,387 L578* probably null Het
Sptan1 A T 2: 29,993,724 probably benign Het
St5 T C 7: 109,556,790 Y251C probably benign Het
Sult2a4 T G 7: 13,988,391 I50L probably benign Het
Taar6 T C 10: 23,984,785 T288A possibly damaging Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmem98 T C 11: 80,819,932 V139A probably damaging Het
Triobp T C 15: 78,967,754 Y703H probably benign Het
Ttc25 G A 11: 100,549,893 D67N probably damaging Het
Ttc34 A G 4: 154,862,246 T868A probably benign Het
Ttn C T 2: 76,834,881 probably benign Het
Vipas39 A T 12: 87,239,827 W470R probably damaging Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Vmn2r111 T C 17: 22,571,020 N335S possibly damaging Het
Vmn2r70 A G 7: 85,559,179 Y697H probably damaging Het
Wnk4 C A 11: 101,265,377 R461S probably damaging Het
Xylb T A 9: 119,364,501 L87Q probably damaging Het
Zcchc9 T A 13: 91,797,162 K101* probably null Het
Zfp503 C A 14: 21,985,637 A404S probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Fam49b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01907:Fam49b APN 15 63931686 splice site probably benign
IGL01983:Fam49b APN 15 63937387 missense probably benign 0.00
Topsy UTSW 15 63938677 missense probably damaging 0.99
turvey UTSW 15 63956598 critical splice donor site probably null
Upsidedown UTSW 15 63938658 splice site probably null
PIT4480001:Fam49b UTSW 15 63956641 missense probably benign 0.42
R3956:Fam49b UTSW 15 63941974 missense probably damaging 1.00
R5484:Fam49b UTSW 15 63943207 missense probably damaging 1.00
R5723:Fam49b UTSW 15 63956598 critical splice donor site probably null
R7260:Fam49b UTSW 15 63957589 missense possibly damaging 0.65
R7368:Fam49b UTSW 15 63938658 splice site probably null
R8053:Fam49b UTSW 15 63941983 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAGTGTCCATAGTCCAACTC -3'
(R):5'- AAATAGGAGCCAGATTATTTGCTGG -3'

Sequencing Primer
(F):5'- GTGTCCATAGTCCAACTCTATGTTTC -3'
(R):5'- AGCCAGATTATTTGCTGGTTTCTG -3'
Posted On2016-07-06