Mutagenetix > Incidental Mutations

Incidental Mutation 'R5181:Triobp'

397574

Institutional Source

Beutler Lab

Gene Symbol

Triobp

Ensembl Gene

ENSMUSG00000033088

Gene Name

TRIO and F-actin binding protein

Synonyms

EST478828, Mus EST 478828, Tara

MMRRC Submission

042761-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5181 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78947724-79005869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78967754 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 703 (Y703H)

Ref Sequence

ENSEMBL: ENSMUSP00000155397 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228]

Predicted Effect

probably benign
Transcript: ENSMUST00000109689
AA Change: Y703H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: Y703H

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	7.43e-13	PROSPERO
internal_repeat_1	390	540	7.43e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1395	1492	6.2e-19	SMART
coiled coil region	1665	1692	N/A	INTRINSIC
coiled coil region	1727	1765	N/A	INTRINSIC
coiled coil region	1789	1851	N/A	INTRINSIC
coiled coil region	1885	1964	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109690
AA Change: Y703H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: Y703H

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	9.24e-13	PROSPERO
internal_repeat_1	390	540	9.24e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1441	1538	6.2e-19	SMART
coiled coil region	1711	1738	N/A	INTRINSIC
coiled coil region	1773	1811	N/A	INTRINSIC
coiled coil region	1835	1897	N/A	INTRINSIC
coiled coil region	1931	2010	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140228
AA Change: Y703H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.1028

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	T	A	5: 8,714,937	D642E	probably benign	Het
Anxa2	T	C	9: 69,476,065	V54A	probably benign	Het
Ccnb1	C	G	13: 100,781,775	Q121H	possibly damaging	Het
Cdca2	A	G	14: 67,680,165	S595P	probably damaging	Het
Cenpe	G	A	3: 135,242,303	E1208K	probably damaging	Het
Cfh	T	C	1: 140,147,646		probably benign	Het
Colq	T	A	14: 31,557,842	H9L	probably benign	Het
Coq8b	T	C	7: 27,252,322	I403T	possibly damaging	Het
Dcdc2a	C	A	13: 25,202,364	T407K	possibly damaging	Het
Fam198b	A	T	3: 79,886,311	S29C	probably benign	Het
Fam49b	T	A	15: 63,938,677	M234L	probably damaging	Het
Grhl3	T	A	4: 135,559,104	K89*	probably null	Het
Inpp5f	A	G	7: 128,679,831	T519A	probably damaging	Het
Isl2	G	T	9: 55,542,277	R79L	probably benign	Het
Kif9	T	A	9: 110,521,268	D742E	probably damaging	Het
Lgi2	T	A	5: 52,554,450	K176M	probably damaging	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lrch4	A	G	5: 137,629,403	D66G	probably damaging	Het
Milr1	G	A	11: 106,754,980	G116D	probably damaging	Het
Myof	T	C	19: 37,932,623	D1397G	possibly damaging	Het
Neurod2	T	C	11: 98,327,378	H320R	probably benign	Het
Nox3	A	T	17: 3,635,286	Y562*	probably null	Het
Nrap	G	A	19: 56,345,528	H884Y	possibly damaging	Het
Pde3a	T	C	6: 141,481,255		probably null	Het
Pgm2l1	G	A	7: 100,261,758	C303Y	probably benign	Het
Phip	A	G	9: 82,871,190		probably benign	Het
Plxna4	A	G	6: 32,516,997	I228T	probably damaging	Het
Prdm2	A	G	4: 143,134,966	S585P	probably benign	Het
Prpf6	T	C	2: 181,649,546	I718T	probably damaging	Het
Rpp40	T	C	13: 35,896,712		probably null	Het
Skiv2l	T	C	17: 34,844,826	D547G	probably benign	Het
Slc22a22	T	A	15: 57,255,123	Y264F	probably benign	Het
Slc5a4b	A	T	10: 76,060,387	L578*	probably null	Het
Sptan1	A	T	2: 29,993,724		probably benign	Het
St5	T	C	7: 109,556,790	Y251C	probably benign	Het
Sult2a4	T	G	7: 13,988,391	I50L	probably benign	Het
Taar6	T	C	10: 23,984,785	T288A	possibly damaging	Het
Tmem71	C	T	15: 66,555,214	S44N	probably benign	Het
Tmem98	T	C	11: 80,819,932	V139A	probably damaging	Het
Ttc25	G	A	11: 100,549,893	D67N	probably damaging	Het
Ttc34	A	G	4: 154,862,246	T868A	probably benign	Het
Ttn	C	T	2: 76,834,881		probably benign	Het
Vipas39	A	T	12: 87,239,827	W470R	probably damaging	Het
Vmn2r102	T	C	17: 19,676,741	Y117H	probably benign	Het
Vmn2r111	T	C	17: 22,571,020	N335S	possibly damaging	Het
Vmn2r70	A	G	7: 85,559,179	Y697H	probably damaging	Het
Wnk4	C	A	11: 101,265,377	R461S	probably damaging	Het
Xylb	T	A	9: 119,364,501	L87Q	probably damaging	Het
Zcchc9	T	A	13: 91,797,162	K101*	probably null	Het
Zfp503	C	A	14: 21,985,637	A404S	probably benign	Het
Zhx1	C	G	15: 58,054,074	G259R	probably damaging	Het

Other mutations in Triobp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01634:Triobp	APN	15	78993368	missense	probably damaging	1.00
IGL01904:Triobp	APN	15	78967364	missense	possibly damaging	0.80
IGL01957:Triobp	APN	15	78972647	critical splice donor site	probably null
IGL02085:Triobp	APN	15	78974297	splice site	probably benign
IGL02260:Triobp	APN	15	78966362	missense	probably benign	0.00
IGL02498:Triobp	APN	15	78961043	missense	probably benign	0.01
IGL02551:Triobp	APN	15	78973489	missense	probably benign
IGL02740:Triobp	APN	15	78966689	missense	probably benign	0.21
IGL02810:Triobp	APN	15	79002203	missense	possibly damaging	0.95
IGL03063:Triobp	APN	15	78990884	missense	probably damaging	1.00
FR4304:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4340:Triobp	UTSW	15	78993390	unclassified	probably benign
FR4342:Triobp	UTSW	15	78993392	unclassified	probably benign
FR4449:Triobp	UTSW	15	78993389	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993390	unclassified	probably benign
R0276:Triobp	UTSW	15	78973676	missense	probably benign	0.09
R0309:Triobp	UTSW	15	78976540	missense	probably damaging	1.00
R0433:Triobp	UTSW	15	78968201	missense	possibly damaging	0.69
R0464:Triobp	UTSW	15	78966986	missense	possibly damaging	0.71
R0525:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0665:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0689:Triobp	UTSW	15	78959988	nonsense	probably null
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1151:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1152:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1510:Triobp	UTSW	15	79003767	missense	probably damaging	1.00
R1519:Triobp	UTSW	15	78973738	missense	probably benign	0.00
R1642:Triobp	UTSW	15	79002148	missense	probably damaging	1.00
R1732:Triobp	UTSW	15	78967228	missense	possibly damaging	0.69
R1755:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1975:Triobp	UTSW	15	78966708	missense	probably benign
R2051:Triobp	UTSW	15	79004540	missense	probably damaging	1.00
R2073:Triobp	UTSW	15	78973895	missense	probably damaging	0.99
R2260:Triobp	UTSW	15	78991440	critical splice donor site	probably null
R2351:Triobp	UTSW	15	79004580	missense	probably benign	0.09
R2902:Triobp	UTSW	15	78973418	missense	possibly damaging	0.90
R3801:Triobp	UTSW	15	78973700	missense	probably benign	0.04
R3959:Triobp	UTSW	15	79002389	nonsense	probably null
R4003:Triobp	UTSW	15	78959977	unclassified	probably benign
R4084:Triobp	UTSW	15	78973671	missense	probably benign	0.19
R4482:Triobp	UTSW	15	78966563	missense	possibly damaging	0.87
R4592:Triobp	UTSW	15	78967095	missense	probably benign
R4662:Triobp	UTSW	15	78993269	missense	probably damaging	1.00
R4732:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4733:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4789:Triobp	UTSW	15	78991028	missense	probably damaging	1.00
R4968:Triobp	UTSW	15	78966616	missense	probably benign	0.03
R4990:Triobp	UTSW	15	78967005	missense	probably benign	0.00
R5129:Triobp	UTSW	15	78961096	missense	probably benign	0.15
R5279:Triobp	UTSW	15	78994391	missense	possibly damaging	0.66
R5584:Triobp	UTSW	15	78968132	missense	possibly damaging	0.89
R5601:Triobp	UTSW	15	78973633	missense	probably damaging	1.00
R5810:Triobp	UTSW	15	78968267	missense	probably benign	0.07
R5969:Triobp	UTSW	15	78967540	missense	probably benign	0.05
R6722:Triobp	UTSW	15	79001565	missense	probably damaging	1.00
R6739:Triobp	UTSW	15	78966366	missense	possibly damaging	0.77
R6810:Triobp	UTSW	15	78966615	missense	possibly damaging	0.47
R7011:Triobp	UTSW	15	78978723	missense	probably damaging	0.98
R7015:Triobp	UTSW	15	78994060	missense	probably damaging	0.99
R7200:Triobp	UTSW	15	78966842	small deletion	probably benign
R7294:Triobp	UTSW	15	78973976	missense	probably damaging	0.99
X0026:Triobp	UTSW	15	78960023	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- AGGCTAGCTCACAATGACCC -3'
(R):5'- CAGCATCTGATGTGTCTGGG -3'

Sequencing Primer
(F):5'- AGCAGTATTCGCCATCCCTGG -3'
(R):5'- CATCTGATGTGTCTGGGAGGAAG -3'

Posted On

2016-07-06