Incidental Mutation 'R5182:Cep350'
ID397583
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
MMRRC Submission 042853-MU
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5182 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 155858108 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 3013 (L3013R)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138762]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132189
Predicted Effect probably damaging
Transcript: ENSMUST00000138762
AA Change: L3013R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: L3013R

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195048
Meta Mutation Damage Score 0.5574 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A G 19: 21,630,765 M1T probably null Het
Abcg8 T C 17: 84,692,744 L243P probably damaging Het
Ankrd27 A G 7: 35,628,487 T811A probably damaging Het
Auts2 T C 5: 131,475,081 N188S probably null Het
Bak1 G A 17: 27,022,748 P65L possibly damaging Het
Clca3b A G 3: 144,828,015 I533T probably damaging Het
Col6a5 C A 9: 105,857,332 E2637* probably null Het
Coq5 G A 5: 115,279,756 R15H probably benign Het
Dnah5 T G 15: 28,311,278 I1801S probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dpf3 T C 12: 83,370,596 E34G probably damaging Het
Dst C A 1: 34,179,086 Q1536K probably benign Het
Eng T C 2: 32,672,959 probably null Het
Fam102b T C 3: 108,985,351 K173E possibly damaging Het
Fignl1 A T 11: 11,801,717 I446N probably damaging Het
Fras1 C A 5: 96,636,173 C845* probably null Het
Gfm2 T C 13: 97,162,893 V347A probably damaging Het
Gpld1 A T 13: 24,984,070 probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsdmc4 C A 15: 63,893,804 V299F probably damaging Het
Hrnr A T 3: 93,332,143 R3229S unknown Het
Icam5 A G 9: 21,034,810 T313A probably benign Het
Ift172 T A 5: 31,267,614 D668V possibly damaging Het
Kdm5a T A 6: 120,388,105 C322* probably null Het
Klk6 A G 7: 43,828,660 K152R probably benign Het
Man1a2 A C 3: 100,647,017 I250S probably damaging Het
Nkpd1 A G 7: 19,523,256 Y170C probably damaging Het
Nmd3 T A 3: 69,722,468 probably null Het
Olfr131 A G 17: 38,082,114 M288T probably benign Het
Olfr566 A T 7: 102,856,969 D104E probably benign Het
Pax4 C T 6: 28,444,369 E229K probably benign Het
Pdc T C 1: 150,333,354 I196T possibly damaging Het
Pld1 T C 3: 28,045,081 I299T probably damaging Het
Pnma1 T C 12: 84,147,045 I295V probably benign Het
Prkg2 T A 5: 99,024,709 Y49F probably benign Het
Psmd12 T C 11: 107,479,659 L28P probably damaging Het
Ptprg A G 14: 12,154,174 T632A probably benign Het
Rab43 A G 6: 87,794,655 *118R probably null Het
Rabep1 C T 11: 70,904,628 R227* probably null Het
Rad51c T G 11: 87,397,719 I213L possibly damaging Het
Ranbp17 A T 11: 33,219,287 probably benign Het
Ryr3 T C 2: 112,755,150 E2735G probably damaging Het
Sdc3 A G 4: 130,821,684 probably benign Het
Sirpa G A 2: 129,615,732 R242H possibly damaging Het
Slc12a4 G A 8: 105,944,606 T983M probably damaging Het
Snx7 A G 3: 117,832,857 Y252H probably damaging Het
St18 C T 1: 6,817,653 T482I probably benign Het
St7 A G 6: 17,846,237 Y163C probably damaging Het
Tas2r137 A T 6: 40,491,932 Q232L probably benign Het
Tgm6 A T 2: 130,141,302 K270N probably damaging Het
Tiam2 G A 17: 3,438,721 G768D probably damaging Het
Ttn C T 2: 76,870,429 probably benign Het
Ube4b A C 4: 149,381,242 S250R probably null Het
Ubxn2a G A 12: 4,880,634 A242V probably damaging Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Vmn1r222 A G 13: 23,232,497 L182P probably damaging Het
Vmn2r114 A G 17: 23,291,658 V616A probably damaging Het
Vps13a A G 19: 16,695,499 V1303A possibly damaging Het
Wnk2 G T 13: 49,061,161 T1315K possibly damaging Het
Zfp936 G A 7: 43,189,907 C266Y probably damaging Het
Zscan20 G T 4: 128,586,711 N662K possibly damaging Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
R7336:Cep350 UTSW 1 155862276 missense probably benign 0.17
R7361:Cep350 UTSW 1 155901491 missense probably damaging 1.00
R7390:Cep350 UTSW 1 155866087 missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155928215 missense probably benign 0.00
R7428:Cep350 UTSW 1 155894619 missense probably benign 0.00
R7440:Cep350 UTSW 1 155940772 missense probably damaging 0.98
R7520:Cep350 UTSW 1 155915629 missense probably benign 0.05
R7529:Cep350 UTSW 1 155861923 missense probably benign 0.08
R7635:Cep350 UTSW 1 155879021 nonsense probably null
R7806:Cep350 UTSW 1 155862063 missense probably benign 0.00
RF020:Cep350 UTSW 1 155915478 missense probably benign 0.34
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AAGCCATTCCTCACACTGAG -3'
(R):5'- AGGTGACTGCAGTCTGAGTG -3'

Sequencing Primer
(F):5'- CTCACACTGAGGAGAGGAGATGC -3'
(R):5'- GAGTGTTTGAGATGCTTTCCCTCC -3'
Posted On2016-07-06