Incidental Mutation 'R5182:Auts2'
ID397605
Institutional Source Beutler Lab
Gene Symbol Auts2
Ensembl Gene ENSMUSG00000029673
Gene Nameautism susceptibility candidate 2
SynonymsD830032G16Rik, 2700063G02Rik, A730011F23Rik
MMRRC Submission 042853-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5182 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location131437333-132543344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131475081 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 188 (N188S)
Ref Sequence ENSEMBL: ENSMUSP00000139759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161374] [ENSMUST00000161804] [ENSMUST00000187544]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160071
SMART Domains Protein: ENSMUSP00000125349
Gene: ENSMUSG00000029673

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 194 406 2.3e-108 PFAM
low complexity region 433 446 N/A INTRINSIC
low complexity region 555 565 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 763 779 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161226
SMART Domains Protein: ENSMUSP00000124900
Gene: ENSMUSG00000029673

DomainStartEndE-ValueType
low complexity region 11 45 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 133 150 N/A INTRINSIC
low complexity region 199 214 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
low complexity region 330 355 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161374
SMART Domains Protein: ENSMUSP00000124730
Gene: ENSMUSG00000029673

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 172 384 1.5e-112 PFAM
low complexity region 411 424 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 599 614 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161804
SMART Domains Protein: ENSMUSP00000124027
Gene: ENSMUSG00000029673

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 187 399 3.9e-113 PFAM
low complexity region 426 439 N/A INTRINSIC
low complexity region 548 558 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 756 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183153
Predicted Effect probably null
Transcript: ENSMUST00000187544
AA Change: N188S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139759
Gene: ENSMUSG00000029673
AA Change: N188S

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 83 125 N/A INTRINSIC
low complexity region 127 161 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
low complexity region 212 224 N/A INTRINSIC
low complexity region 276 293 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
Pfam:Auts2 396 608 4.3e-109 PFAM
low complexity region 635 648 N/A INTRINSIC
low complexity region 757 767 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
low complexity region 965 981 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198149
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a brain-specific knockout are smaller than controls, and exhibit behavioral defects such as less vocalizations, impairments in righting response and geotaxis, and decreased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A G 19: 21,630,765 M1T probably null Het
Abcg8 T C 17: 84,692,744 L243P probably damaging Het
Ankrd27 A G 7: 35,628,487 T811A probably damaging Het
Bak1 G A 17: 27,022,748 P65L possibly damaging Het
Cep350 A C 1: 155,858,108 L3013R probably damaging Het
Clca3b A G 3: 144,828,015 I533T probably damaging Het
Col6a5 C A 9: 105,857,332 E2637* probably null Het
Coq5 G A 5: 115,279,756 R15H probably benign Het
Dnah5 T G 15: 28,311,278 I1801S probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dpf3 T C 12: 83,370,596 E34G probably damaging Het
Dst C A 1: 34,179,086 Q1536K probably benign Het
Eng T C 2: 32,672,959 probably null Het
Fam102b T C 3: 108,985,351 K173E possibly damaging Het
Fignl1 A T 11: 11,801,717 I446N probably damaging Het
Fras1 C A 5: 96,636,173 C845* probably null Het
Gfm2 T C 13: 97,162,893 V347A probably damaging Het
Gpld1 A T 13: 24,984,070 probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsdmc4 C A 15: 63,893,804 V299F probably damaging Het
Hrnr A T 3: 93,332,143 R3229S unknown Het
Icam5 A G 9: 21,034,810 T313A probably benign Het
Ift172 T A 5: 31,267,614 D668V possibly damaging Het
Kdm5a T A 6: 120,388,105 C322* probably null Het
Klk6 A G 7: 43,828,660 K152R probably benign Het
Man1a2 A C 3: 100,647,017 I250S probably damaging Het
Nkpd1 A G 7: 19,523,256 Y170C probably damaging Het
Nmd3 T A 3: 69,722,468 probably null Het
Olfr131 A G 17: 38,082,114 M288T probably benign Het
Olfr566 A T 7: 102,856,969 D104E probably benign Het
Pax4 C T 6: 28,444,369 E229K probably benign Het
Pdc T C 1: 150,333,354 I196T possibly damaging Het
Pld1 T C 3: 28,045,081 I299T probably damaging Het
Pnma1 T C 12: 84,147,045 I295V probably benign Het
Prkg2 T A 5: 99,024,709 Y49F probably benign Het
Psmd12 T C 11: 107,479,659 L28P probably damaging Het
Ptprg A G 14: 12,154,174 T632A probably benign Het
Rab43 A G 6: 87,794,655 *118R probably null Het
Rabep1 C T 11: 70,904,628 R227* probably null Het
Rad51c T G 11: 87,397,719 I213L possibly damaging Het
Ranbp17 A T 11: 33,219,287 probably benign Het
Ryr3 T C 2: 112,755,150 E2735G probably damaging Het
Sdc3 A G 4: 130,821,684 probably benign Het
Sirpa G A 2: 129,615,732 R242H possibly damaging Het
Slc12a4 G A 8: 105,944,606 T983M probably damaging Het
Snx7 A G 3: 117,832,857 Y252H probably damaging Het
St18 C T 1: 6,817,653 T482I probably benign Het
St7 A G 6: 17,846,237 Y163C probably damaging Het
Tas2r137 A T 6: 40,491,932 Q232L probably benign Het
Tgm6 A T 2: 130,141,302 K270N probably damaging Het
Tiam2 G A 17: 3,438,721 G768D probably damaging Het
Ttn C T 2: 76,870,429 probably benign Het
Ube4b A C 4: 149,381,242 S250R probably null Het
Ubxn2a G A 12: 4,880,634 A242V probably damaging Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Vmn1r222 A G 13: 23,232,497 L182P probably damaging Het
Vmn2r114 A G 17: 23,291,658 V616A probably damaging Het
Vps13a A G 19: 16,695,499 V1303A possibly damaging Het
Wnk2 G T 13: 49,061,161 T1315K possibly damaging Het
Zfp936 G A 7: 43,189,907 C266Y probably damaging Het
Zscan20 G T 4: 128,586,711 N662K possibly damaging Het
Other mutations in Auts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Auts2 APN 5 131440218 missense probably benign 0.00
IGL01751:Auts2 APN 5 131472360 missense probably damaging 0.99
IGL02070:Auts2 APN 5 131470421 missense probably damaging 1.00
R0032:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0033:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0046:Auts2 UTSW 5 131770785 exon noncoding transcript
R0399:Auts2 UTSW 5 131440524 missense probably benign 0.37
R0412:Auts2 UTSW 5 131446831 missense probably benign 0.02
R0551:Auts2 UTSW 5 131440469 missense possibly damaging 0.75
R1536:Auts2 UTSW 5 131487463 intron probably benign
R1573:Auts2 UTSW 5 131440487 missense probably damaging 1.00
R1789:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R1912:Auts2 UTSW 5 131443574 missense probably damaging 1.00
R2431:Auts2 UTSW 5 132259048 nonsense probably null
R3745:Auts2 UTSW 5 131476587 utr 5 prime probably benign
R4290:Auts2 UTSW 5 131474971 missense probably damaging 1.00
R4575:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4576:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4578:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4623:Auts2 UTSW 5 131440383 missense probably benign 0.25
R4632:Auts2 UTSW 5 131472275 missense probably damaging 1.00
R4663:Auts2 UTSW 5 131439638 missense probably damaging 1.00
R4835:Auts2 UTSW 5 131466093 missense probably damaging 1.00
R4881:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R5030:Auts2 UTSW 5 131443498 missense probably benign 0.00
R5032:Auts2 UTSW 5 131476891 utr 5 prime probably benign
R5078:Auts2 UTSW 5 132258947 missense possibly damaging 0.85
R5093:Auts2 UTSW 5 131439458 missense probably damaging 0.99
R5305:Auts2 UTSW 5 131443794 intron probably benign
R5429:Auts2 UTSW 5 131472335 missense probably damaging 1.00
R5601:Auts2 UTSW 5 131476823 utr 5 prime probably benign
R5725:Auts2 UTSW 5 131439746 missense probably benign 0.35
R5990:Auts2 UTSW 5 131476895 utr 5 prime probably benign
R6074:Auts2 UTSW 5 131476989 utr 5 prime probably benign
R6130:Auts2 UTSW 5 131440223 missense probably damaging 1.00
R6321:Auts2 UTSW 5 131466115 missense probably damaging 1.00
R6974:Auts2 UTSW 5 131440599 missense probably benign 0.01
R7000:Auts2 UTSW 5 131440218 missense probably benign 0.01
R7014:Auts2 UTSW 5 131466123 missense probably damaging 1.00
R7154:Auts2 UTSW 5 131451893 missense
R7812:Auts2 UTSW 5 131472446 missense
R7922:Auts2 UTSW 5 131440373 missense
R8159:Auts2 UTSW 5 131460125 critical splice donor site probably null
R8553:Auts2 UTSW 5 131440143 missense probably benign 0.00
Z1088:Auts2 UTSW 5 131476554 splice site probably benign
Predicted Primers PCR Primer
(F):5'- GTGGTGACTAGCAAGGGGC -3'
(R):5'- GAAAGAAGAGAGTTAACAGCTTTATTG -3'

Sequencing Primer
(F):5'- TGTGTACCCATGAGATTGCC -3'
(R):5'- GTAATAAAGAAGAGTTGAACAGCAGC -3'
Posted On2016-07-06