Incidental Mutation 'R5182:Col6a5'
ID397621
Institutional Source Beutler Lab
Gene Symbol Col6a5
Ensembl Gene ENSMUSG00000091345
Gene Namecollagen, type VI, alpha 5
SynonymsGm7455, Col6a5
MMRRC Submission 042853-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.874) question?
Stock #R5182 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105856078-105960643 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 105857332 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 2637 (E2637*)
Ref Sequence ENSEMBL: ENSMUSP00000139398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165165] [ENSMUST00000190193]
Predicted Effect probably benign
Transcript: ENSMUST00000165165
SMART Domains Protein: ENSMUSP00000131146
Gene: ENSMUSG00000091345

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.8e-24 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 2.23e-20 SMART
VWA 472 649 6.84e-39 SMART
VWA 658 834 1.52e-45 SMART
VWA 844 1024 2.44e-44 SMART
VWA 1035 1208 2.95e-20 SMART
Pfam:Collagen 1425 1478 3.3e-8 PFAM
low complexity region 1493 1508 N/A INTRINSIC
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 9.6e-10 PFAM
low complexity region 1711 1730 N/A INTRINSIC
low complexity region 1739 1757 N/A INTRINSIC
VWA 1788 1964 1.99e-17 SMART
VWA 1994 2173 5.98e-21 SMART
VWA 2319 2513 4.4e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190193
AA Change: E2637*
SMART Domains Protein: ENSMUSP00000139398
Gene: ENSMUSG00000091345
AA Change: E2637*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.1e-26 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 1.4e-22 SMART
VWA 472 649 4.4e-41 SMART
VWA 658 834 9.5e-48 SMART
VWA 844 1024 1.6e-46 SMART
VWA 1035 1208 1.9e-22 SMART
Pfam:Collagen 1425 1478 1.2e-6 PFAM
Pfam:Collagen 1457 1530 5.9e-6 PFAM
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 3.6e-8 PFAM
Pfam:Collagen 1631 1691 8.4e-6 PFAM
Pfam:Collagen 1706 1764 6.6e-6 PFAM
VWA 1788 1964 1.2e-19 SMART
VWA 1994 2173 3.7e-23 SMART
VWA 2319 2513 2.8e-21 SMART
Meta Mutation Damage Score 0.9191 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the collagen superfamily of proteins. The encoded protein contains multiple von Willebrand factor A-like domains and may interact with the alpha 1 and alpha 2 chains of collagen VI to form the complete collagen VI trimer. Polymorphisms in this gene may be linked to dermal phenotypes, such as eczema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A G 19: 21,630,765 M1T probably null Het
Abcg8 T C 17: 84,692,744 L243P probably damaging Het
Ankrd27 A G 7: 35,628,487 T811A probably damaging Het
Auts2 T C 5: 131,475,081 N188S probably null Het
Bak1 G A 17: 27,022,748 P65L possibly damaging Het
Cep350 A C 1: 155,858,108 L3013R probably damaging Het
Clca3b A G 3: 144,828,015 I533T probably damaging Het
Coq5 G A 5: 115,279,756 R15H probably benign Het
Dnah5 T G 15: 28,311,278 I1801S probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dpf3 T C 12: 83,370,596 E34G probably damaging Het
Dst C A 1: 34,179,086 Q1536K probably benign Het
Eng T C 2: 32,672,959 probably null Het
Fam102b T C 3: 108,985,351 K173E possibly damaging Het
Fignl1 A T 11: 11,801,717 I446N probably damaging Het
Fras1 C A 5: 96,636,173 C845* probably null Het
Gfm2 T C 13: 97,162,893 V347A probably damaging Het
Gpld1 A T 13: 24,984,070 probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsdmc4 C A 15: 63,893,804 V299F probably damaging Het
Hrnr A T 3: 93,332,143 R3229S unknown Het
Icam5 A G 9: 21,034,810 T313A probably benign Het
Ift172 T A 5: 31,267,614 D668V possibly damaging Het
Kdm5a T A 6: 120,388,105 C322* probably null Het
Klk6 A G 7: 43,828,660 K152R probably benign Het
Man1a2 A C 3: 100,647,017 I250S probably damaging Het
Nkpd1 A G 7: 19,523,256 Y170C probably damaging Het
Nmd3 T A 3: 69,722,468 probably null Het
Olfr131 A G 17: 38,082,114 M288T probably benign Het
Olfr566 A T 7: 102,856,969 D104E probably benign Het
Pax4 C T 6: 28,444,369 E229K probably benign Het
Pdc T C 1: 150,333,354 I196T possibly damaging Het
Pld1 T C 3: 28,045,081 I299T probably damaging Het
Pnma1 T C 12: 84,147,045 I295V probably benign Het
Prkg2 T A 5: 99,024,709 Y49F probably benign Het
Psmd12 T C 11: 107,479,659 L28P probably damaging Het
Ptprg A G 14: 12,154,174 T632A probably benign Het
Rab43 A G 6: 87,794,655 *118R probably null Het
Rabep1 C T 11: 70,904,628 R227* probably null Het
Rad51c T G 11: 87,397,719 I213L possibly damaging Het
Ranbp17 A T 11: 33,219,287 probably benign Het
Ryr3 T C 2: 112,755,150 E2735G probably damaging Het
Sdc3 A G 4: 130,821,684 probably benign Het
Sirpa G A 2: 129,615,732 R242H possibly damaging Het
Slc12a4 G A 8: 105,944,606 T983M probably damaging Het
Snx7 A G 3: 117,832,857 Y252H probably damaging Het
St18 C T 1: 6,817,653 T482I probably benign Het
St7 A G 6: 17,846,237 Y163C probably damaging Het
Tas2r137 A T 6: 40,491,932 Q232L probably benign Het
Tgm6 A T 2: 130,141,302 K270N probably damaging Het
Tiam2 G A 17: 3,438,721 G768D probably damaging Het
Ttn C T 2: 76,870,429 probably benign Het
Ube4b A C 4: 149,381,242 S250R probably null Het
Ubxn2a G A 12: 4,880,634 A242V probably damaging Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Vmn1r222 A G 13: 23,232,497 L182P probably damaging Het
Vmn2r114 A G 17: 23,291,658 V616A probably damaging Het
Vps13a A G 19: 16,695,499 V1303A possibly damaging Het
Wnk2 G T 13: 49,061,161 T1315K possibly damaging Het
Zfp936 G A 7: 43,189,907 C266Y probably damaging Het
Zscan20 G T 4: 128,586,711 N662K possibly damaging Het
Other mutations in Col6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Col6a5 APN 9 105882683 missense probably damaging 1.00
IGL01462:Col6a5 APN 9 105946075 missense unknown
IGL01530:Col6a5 APN 9 105915186 splice site probably benign
IGL01717:Col6a5 APN 9 105940273 missense unknown
IGL01859:Col6a5 APN 9 105930961 nonsense probably null
IGL01945:Col6a5 APN 9 105928290 missense unknown
IGL01985:Col6a5 APN 9 105937283 missense unknown
IGL02128:Col6a5 APN 9 105939894 missense unknown
IGL02170:Col6a5 APN 9 105928422 missense unknown
IGL02224:Col6a5 APN 9 105864335 missense probably damaging 1.00
IGL02246:Col6a5 APN 9 105911107 nonsense probably null
IGL02304:Col6a5 APN 9 105928414 missense unknown
IGL02338:Col6a5 APN 9 105878630 missense probably damaging 1.00
IGL02375:Col6a5 APN 9 105906113 missense unknown
IGL02660:Col6a5 APN 9 105936886 missense unknown
IGL02829:Col6a5 APN 9 105934307 missense unknown
IGL02882:Col6a5 APN 9 105934321 missense unknown
IGL02973:Col6a5 APN 9 105925821 missense unknown
IGL03089:Col6a5 APN 9 105933839 missense unknown
IGL03100:Col6a5 APN 9 105937313 missense unknown
IGL03257:Col6a5 APN 9 105881873 missense possibly damaging 0.95
FR4340:Col6a5 UTSW 9 105934174 missense unknown
FR4342:Col6a5 UTSW 9 105934174 missense unknown
FR4589:Col6a5 UTSW 9 105934174 missense unknown
PIT4131001:Col6a5 UTSW 9 105881914 missense probably damaging 0.98
R0147:Col6a5 UTSW 9 105925794 missense unknown
R0549:Col6a5 UTSW 9 105904579 splice site probably benign
R0622:Col6a5 UTSW 9 105925852 missense unknown
R0628:Col6a5 UTSW 9 105912450 splice site probably null
R0635:Col6a5 UTSW 9 105928606 missense unknown
R0644:Col6a5 UTSW 9 105948324 critical splice donor site probably null
R0828:Col6a5 UTSW 9 105862064 critical splice acceptor site probably null
R0972:Col6a5 UTSW 9 105940285 missense unknown
R1065:Col6a5 UTSW 9 105881783 missense probably damaging 0.99
R1142:Col6a5 UTSW 9 105934317 missense unknown
R1169:Col6a5 UTSW 9 105896974 splice site probably null
R1522:Col6a5 UTSW 9 105939994 missense unknown
R1646:Col6a5 UTSW 9 105862749 nonsense probably null
R1719:Col6a5 UTSW 9 105931293 missense unknown
R1759:Col6a5 UTSW 9 105930846 missense unknown
R1780:Col6a5 UTSW 9 105936878 missense unknown
R1812:Col6a5 UTSW 9 105928054 missense unknown
R1838:Col6a5 UTSW 9 105864833 missense probably benign 0.28
R1839:Col6a5 UTSW 9 105864833 missense probably benign 0.28
R1863:Col6a5 UTSW 9 105940201 missense unknown
R1900:Col6a5 UTSW 9 105931213 missense unknown
R1951:Col6a5 UTSW 9 105936957 missense unknown
R2024:Col6a5 UTSW 9 105936994 missense unknown
R2126:Col6a5 UTSW 9 105945600 missense unknown
R2319:Col6a5 UTSW 9 105937218 missense unknown
R2344:Col6a5 UTSW 9 105928537 missense unknown
R2483:Col6a5 UTSW 9 105864148 missense probably damaging 1.00
R3176:Col6a5 UTSW 9 105911107 nonsense probably null
R3276:Col6a5 UTSW 9 105911107 nonsense probably null
R3438:Col6a5 UTSW 9 105875792 missense possibly damaging 0.88
R3791:Col6a5 UTSW 9 105864669 missense probably damaging 0.99
R3840:Col6a5 UTSW 9 105928611 missense unknown
R3886:Col6a5 UTSW 9 105930930 missense unknown
R3941:Col6a5 UTSW 9 105939834 missense unknown
R4194:Col6a5 UTSW 9 105945914 missense unknown
R4399:Col6a5 UTSW 9 105888965 missense possibly damaging 0.75
R4421:Col6a5 UTSW 9 105928473 missense unknown
R4450:Col6a5 UTSW 9 105904521 missense unknown
R4491:Col6a5 UTSW 9 105940012 missense unknown
R4582:Col6a5 UTSW 9 105862764 missense probably benign 0.17
R4693:Col6a5 UTSW 9 105937172 missense unknown
R4787:Col6a5 UTSW 9 105931081 missense unknown
R4789:Col6a5 UTSW 9 105937335 missense unknown
R4791:Col6a5 UTSW 9 105930784 missense unknown
R4792:Col6a5 UTSW 9 105930784 missense unknown
R4817:Col6a5 UTSW 9 105934298 missense unknown
R4854:Col6a5 UTSW 9 105898751 missense probably benign 0.18
R4927:Col6a5 UTSW 9 105933964 missense unknown
R4969:Col6a5 UTSW 9 105864607 missense probably damaging 1.00
R5037:Col6a5 UTSW 9 105928138 missense unknown
R5118:Col6a5 UTSW 9 105937005 missense unknown
R5144:Col6a5 UTSW 9 105889283 missense probably damaging 1.00
R5145:Col6a5 UTSW 9 105934245 missense unknown
R5160:Col6a5 UTSW 9 105931009 missense unknown
R5234:Col6a5 UTSW 9 105864205 missense probably damaging 1.00
R5252:Col6a5 UTSW 9 105940290 missense unknown
R5290:Col6a5 UTSW 9 105946083 missense unknown
R5313:Col6a5 UTSW 9 105945544 missense unknown
R5321:Col6a5 UTSW 9 105928465 missense unknown
R5466:Col6a5 UTSW 9 105931083 missense unknown
R5540:Col6a5 UTSW 9 105862776 missense probably benign 0.44
R5669:Col6a5 UTSW 9 105925998 missense unknown
R5789:Col6a5 UTSW 9 105864608 missense possibly damaging 0.91
R5801:Col6a5 UTSW 9 105948367 missense unknown
R5827:Col6a5 UTSW 9 105928120 nonsense probably null
R5839:Col6a5 UTSW 9 105945393 critical splice donor site probably null
R5908:Col6a5 UTSW 9 105862801 missense possibly damaging 0.88
R5970:Col6a5 UTSW 9 105945847 missense unknown
R6045:Col6a5 UTSW 9 105925918 missense unknown
R6107:Col6a5 UTSW 9 105892272 nonsense probably null
R6168:Col6a5 UTSW 9 105875787 critical splice donor site probably null
R6315:Col6a5 UTSW 9 105881970 missense probably damaging 1.00
R6317:Col6a5 UTSW 9 105889067 missense probably damaging 1.00
R6414:Col6a5 UTSW 9 105892266 splice site probably null
R6434:Col6a5 UTSW 9 105937345 missense unknown
R6456:Col6a5 UTSW 9 105945477 missense unknown
R6698:Col6a5 UTSW 9 105934175 missense unknown
R6876:Col6a5 UTSW 9 105937307 missense unknown
R6882:Col6a5 UTSW 9 105940270 nonsense probably null
R6928:Col6a5 UTSW 9 105939919 missense unknown
R7024:Col6a5 UTSW 9 105912475 nonsense probably null
R7038:Col6a5 UTSW 9 105945738 missense unknown
R7082:Col6a5 UTSW 9 105931239 missense unknown
R7158:Col6a5 UTSW 9 105864208 missense possibly damaging 0.90
R7211:Col6a5 UTSW 9 105928164 missense unknown
R7431:Col6a5 UTSW 9 105928269 missense unknown
R7440:Col6a5 UTSW 9 105881431 nonsense probably null
R7502:Col6a5 UTSW 9 105875876 missense probably benign 0.05
R7577:Col6a5 UTSW 9 105864688 nonsense probably null
R7582:Col6a5 UTSW 9 105945426 missense unknown
R7641:Col6a5 UTSW 9 105881426 nonsense probably null
R7762:Col6a5 UTSW 9 105931324 missense unknown
R7793:Col6a5 UTSW 9 105898735 missense probably damaging 1.00
R7821:Col6a5 UTSW 9 105864259 missense probably damaging 1.00
R7848:Col6a5 UTSW 9 105928186 missense unknown
R7897:Col6a5 UTSW 9 105889183 missense possibly damaging 0.96
R7904:Col6a5 UTSW 9 105928521 missense unknown
R8015:Col6a5 UTSW 9 105881741 missense possibly damaging 0.65
R8100:Col6a5 UTSW 9 105878640 missense probably damaging 1.00
R8131:Col6a5 UTSW 9 105901616 missense unknown
RF013:Col6a5 UTSW 9 105878597 frame shift probably null
X0054:Col6a5 UTSW 9 105915158 missense unknown
X0058:Col6a5 UTSW 9 105881778 nonsense probably null
Z1088:Col6a5 UTSW 9 105926067 missense unknown
Z1177:Col6a5 UTSW 9 105930785 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGATGAAACCCGGTCCTAG -3'
(R):5'- TTCTCCATGGACCTAGATGACTC -3'

Sequencing Primer
(F):5'- AAACCCGGTCCTAGTTTTGAAGGTC -3'
(R):5'- AGATGACTCTAGGTTGGACTTTTAG -3'
Posted On2016-07-06