Incidental Mutation 'R5182:Bak1'
ID397640
Institutional Source Beutler Lab
Gene Symbol Bak1
Ensembl Gene ENSMUSG00000057789
Gene NameBCL2-antagonist/killer 1
SynonymsN-Bak, Bak
MMRRC Submission 042853-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5182 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location27019810-27029009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27022748 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 65 (P65L)
Ref Sequence ENSEMBL: ENSMUSP00000025034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025034] [ENSMUST00000078691] [ENSMUST00000122106] [ENSMUST00000133257]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025034
AA Change: P65L

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025034
Gene: ENSMUSG00000057789
AA Change: P65L

DomainStartEndE-ValueType
SCOP:d1f16a_ 15 114 2e-18 SMART
PDB:2M5B|A 18 126 1e-50 PDB
Blast:BCL 33 66 2e-10 BLAST
Blast:BCL 76 126 2e-20 BLAST
low complexity region 127 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078691
AA Change: P65L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077757
Gene: ENSMUSG00000057789
AA Change: P65L

DomainStartEndE-ValueType
BCL 76 175 2.2e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122106
SMART Domains Protein: ENSMUSP00000113880
Gene: ENSMUSG00000048731

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Ubiquitin_3 172 260 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133257
SMART Domains Protein: ENSMUSP00000115777
Gene: ENSMUSG00000048731

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
internal_repeat_1 264 280 1.14e-6 PROSPERO
Pfam:Ubiquitin_3 281 368 1.5e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133448
SMART Domains Protein: ENSMUSP00000122800
Gene: ENSMUSG00000057789

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142141
Predicted Effect unknown
Transcript: ENSMUST00000143158
AA Change: P13L
SMART Domains Protein: ENSMUSP00000122521
Gene: ENSMUSG00000057789
AA Change: P13L

DomainStartEndE-ValueType
PDB:2YV6|A 2 64 2e-29 PDB
SCOP:d1k3ka_ 6 75 4e-14 SMART
Blast:BCL 25 64 6e-21 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151920
Meta Mutation Damage Score 0.1160 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form oligomers or heterodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein localizes to mitochondria, and functions to induce apoptosis. It interacts with and accelerates the opening of the mitochondrial voltage-dependent anion channel, which leads to a loss in membrane potential and the release of cytochrome c. This protein also interacts with the tumor suppressor P53 after exposure to cell stress. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A G 19: 21,630,765 M1T probably null Het
Abcg8 T C 17: 84,692,744 L243P probably damaging Het
Ankrd27 A G 7: 35,628,487 T811A probably damaging Het
Auts2 T C 5: 131,475,081 N188S probably null Het
Cep350 A C 1: 155,858,108 L3013R probably damaging Het
Clca3b A G 3: 144,828,015 I533T probably damaging Het
Col6a5 C A 9: 105,857,332 E2637* probably null Het
Coq5 G A 5: 115,279,756 R15H probably benign Het
Dnah5 T G 15: 28,311,278 I1801S probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dpf3 T C 12: 83,370,596 E34G probably damaging Het
Dst C A 1: 34,179,086 Q1536K probably benign Het
Eng T C 2: 32,672,959 probably null Het
Fam102b T C 3: 108,985,351 K173E possibly damaging Het
Fignl1 A T 11: 11,801,717 I446N probably damaging Het
Fras1 C A 5: 96,636,173 C845* probably null Het
Gfm2 T C 13: 97,162,893 V347A probably damaging Het
Gpld1 A T 13: 24,984,070 probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsdmc4 C A 15: 63,893,804 V299F probably damaging Het
Hrnr A T 3: 93,332,143 R3229S unknown Het
Icam5 A G 9: 21,034,810 T313A probably benign Het
Ift172 T A 5: 31,267,614 D668V possibly damaging Het
Kdm5a T A 6: 120,388,105 C322* probably null Het
Klk6 A G 7: 43,828,660 K152R probably benign Het
Man1a2 A C 3: 100,647,017 I250S probably damaging Het
Nkpd1 A G 7: 19,523,256 Y170C probably damaging Het
Nmd3 T A 3: 69,722,468 probably null Het
Olfr131 A G 17: 38,082,114 M288T probably benign Het
Olfr566 A T 7: 102,856,969 D104E probably benign Het
Pax4 C T 6: 28,444,369 E229K probably benign Het
Pdc T C 1: 150,333,354 I196T possibly damaging Het
Pld1 T C 3: 28,045,081 I299T probably damaging Het
Pnma1 T C 12: 84,147,045 I295V probably benign Het
Prkg2 T A 5: 99,024,709 Y49F probably benign Het
Psmd12 T C 11: 107,479,659 L28P probably damaging Het
Ptprg A G 14: 12,154,174 T632A probably benign Het
Rab43 A G 6: 87,794,655 *118R probably null Het
Rabep1 C T 11: 70,904,628 R227* probably null Het
Rad51c T G 11: 87,397,719 I213L possibly damaging Het
Ranbp17 A T 11: 33,219,287 probably benign Het
Ryr3 T C 2: 112,755,150 E2735G probably damaging Het
Sdc3 A G 4: 130,821,684 probably benign Het
Sirpa G A 2: 129,615,732 R242H possibly damaging Het
Slc12a4 G A 8: 105,944,606 T983M probably damaging Het
Snx7 A G 3: 117,832,857 Y252H probably damaging Het
St18 C T 1: 6,817,653 T482I probably benign Het
St7 A G 6: 17,846,237 Y163C probably damaging Het
Tas2r137 A T 6: 40,491,932 Q232L probably benign Het
Tgm6 A T 2: 130,141,302 K270N probably damaging Het
Tiam2 G A 17: 3,438,721 G768D probably damaging Het
Ttn C T 2: 76,870,429 probably benign Het
Ube4b A C 4: 149,381,242 S250R probably null Het
Ubxn2a G A 12: 4,880,634 A242V probably damaging Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Vmn1r222 A G 13: 23,232,497 L182P probably damaging Het
Vmn2r114 A G 17: 23,291,658 V616A probably damaging Het
Vps13a A G 19: 16,695,499 V1303A possibly damaging Het
Wnk2 G T 13: 49,061,161 T1315K possibly damaging Het
Zfp936 G A 7: 43,189,907 C266Y probably damaging Het
Zscan20 G T 4: 128,586,711 N662K possibly damaging Het
Other mutations in Bak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02734:Bak1 APN 17 27020953 missense possibly damaging 0.62
R1056:Bak1 UTSW 17 27021273 missense possibly damaging 0.83
R1806:Bak1 UTSW 17 27021268 nonsense probably null
R4135:Bak1 UTSW 17 27021270 missense possibly damaging 0.66
R4422:Bak1 UTSW 17 27021324 missense probably damaging 1.00
R4664:Bak1 UTSW 17 27022536 missense possibly damaging 0.81
R5185:Bak1 UTSW 17 27022748 missense possibly damaging 0.86
R6469:Bak1 UTSW 17 27021319 missense probably damaging 1.00
R7155:Bak1 UTSW 17 27022460 missense possibly damaging 0.82
R7999:Bak1 UTSW 17 27021306 missense probably damaging 1.00
R8086:Bak1 UTSW 17 27020937 missense probably benign 0.21
X0066:Bak1 UTSW 17 27022569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTAGCGCCGGTTAATATCATC -3'
(R):5'- TTGGGACAGCTTGCCTTTGC -3'

Sequencing Primer
(F):5'- TCTCCGATGAGAGCAAGCTG -3'
(R):5'- GCTGACCCCCAGTTCTGATCTG -3'
Posted On2016-07-06