Incidental Mutation 'R5182:Vps13a'
ID397643
Institutional Source Beutler Lab
Gene Symbol Vps13a
Ensembl Gene ENSMUSG00000046230
Gene Namevacuolar protein sorting 13A
Synonyms4930516E05Rik, 4930543C13Rik, D330038K10Rik
MMRRC Submission 042853-MU
Accession Numbers

Ncbi RefSeq: NM_173028.4; MGI:2444304

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5182 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location16615366-16780933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16695499 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1303 (V1303A)
Ref Sequence ENSEMBL: ENSMUSP00000068716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068156] [ENSMUST00000224149]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068156
AA Change: V1303A

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068716
Gene: ENSMUSG00000046230
AA Change: V1303A

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 5.4e-38 PFAM
Pfam:VPS13 139 371 3.7e-64 PFAM
low complexity region 553 563 N/A INTRINSIC
Pfam:VPS13_mid_rpt 567 791 1.4e-69 PFAM
Pfam:VPS13_mid_rpt 1138 1329 2e-10 PFAM
low complexity region 1367 1377 N/A INTRINSIC
Blast:INB 1575 1855 1e-149 BLAST
Pfam:SHR-BD 2200 2449 1.3e-35 PFAM
low complexity region 2510 2521 N/A INTRINSIC
low complexity region 2632 2648 N/A INTRINSIC
low complexity region 2719 2731 N/A INTRINSIC
Pfam:VPS13_C 2755 2935 8.9e-66 PFAM
Pfam:ATG_C 2938 3029 1.6e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000224149
AA Change: V1303A

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.0849 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype Strain: 3531502
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele display motor dysfunction and abnormal social interaction, hematologic anomalies including acanthocytosis, selective atrophy of the striatum with significant apoptosis and gliosis, and reduced homovanillic acid levels in midbrain. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(5)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A G 19: 21,630,765 M1T probably null Het
Abcg8 T C 17: 84,692,744 L243P probably damaging Het
Ankrd27 A G 7: 35,628,487 T811A probably damaging Het
Auts2 T C 5: 131,475,081 N188S probably null Het
Bak1 G A 17: 27,022,748 P65L possibly damaging Het
Cep350 A C 1: 155,858,108 L3013R probably damaging Het
Clca3b A G 3: 144,828,015 I533T probably damaging Het
Col6a5 C A 9: 105,857,332 E2637* probably null Het
Coq5 G A 5: 115,279,756 R15H probably benign Het
Dnah5 T G 15: 28,311,278 I1801S probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dpf3 T C 12: 83,370,596 E34G probably damaging Het
Dst C A 1: 34,179,086 Q1536K probably benign Het
Eng T C 2: 32,672,959 probably null Het
Fam102b T C 3: 108,985,351 K173E possibly damaging Het
Fignl1 A T 11: 11,801,717 I446N probably damaging Het
Fras1 C A 5: 96,636,173 C845* probably null Het
Gfm2 T C 13: 97,162,893 V347A probably damaging Het
Gpld1 A T 13: 24,984,070 probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsdmc4 C A 15: 63,893,804 V299F probably damaging Het
Hrnr A T 3: 93,332,143 R3229S unknown Het
Icam5 A G 9: 21,034,810 T313A probably benign Het
Ift172 T A 5: 31,267,614 D668V possibly damaging Het
Kdm5a T A 6: 120,388,105 C322* probably null Het
Klk6 A G 7: 43,828,660 K152R probably benign Het
Man1a2 A C 3: 100,647,017 I250S probably damaging Het
Nkpd1 A G 7: 19,523,256 Y170C probably damaging Het
Nmd3 T A 3: 69,722,468 probably null Het
Olfr131 A G 17: 38,082,114 M288T probably benign Het
Olfr566 A T 7: 102,856,969 D104E probably benign Het
Pax4 C T 6: 28,444,369 E229K probably benign Het
Pdc T C 1: 150,333,354 I196T possibly damaging Het
Pld1 T C 3: 28,045,081 I299T probably damaging Het
Pnma1 T C 12: 84,147,045 I295V probably benign Het
Prkg2 T A 5: 99,024,709 Y49F probably benign Het
Psmd12 T C 11: 107,479,659 L28P probably damaging Het
Ptprg A G 14: 12,154,174 T632A probably benign Het
Rab43 A G 6: 87,794,655 *118R probably null Het
Rabep1 C T 11: 70,904,628 R227* probably null Het
Rad51c T G 11: 87,397,719 I213L possibly damaging Het
Ranbp17 A T 11: 33,219,287 probably benign Het
Ryr3 T C 2: 112,755,150 E2735G probably damaging Het
Sdc3 A G 4: 130,821,684 probably benign Het
Sirpa G A 2: 129,615,732 R242H possibly damaging Het
Slc12a4 G A 8: 105,944,606 T983M probably damaging Het
Snx7 A G 3: 117,832,857 Y252H probably damaging Het
St18 C T 1: 6,817,653 T482I probably benign Het
St7 A G 6: 17,846,237 Y163C probably damaging Het
Tas2r137 A T 6: 40,491,932 Q232L probably benign Het
Tgm6 A T 2: 130,141,302 K270N probably damaging Het
Tiam2 G A 17: 3,438,721 G768D probably damaging Het
Ttn C T 2: 76,870,429 probably benign Het
Ube4b A C 4: 149,381,242 S250R probably null Het
Ubxn2a G A 12: 4,880,634 A242V probably damaging Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Vmn1r222 A G 13: 23,232,497 L182P probably damaging Het
Vmn2r114 A G 17: 23,291,658 V616A probably damaging Het
Wnk2 G T 13: 49,061,161 T1315K possibly damaging Het
Zfp936 G A 7: 43,189,907 C266Y probably damaging Het
Zscan20 G T 4: 128,586,711 N662K possibly damaging Het
Other mutations in Vps13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Vps13a APN 19 16752175 missense probably damaging 0.98
IGL00537:Vps13a APN 19 16680045 missense probably benign 0.03
IGL00562:Vps13a APN 19 16734714 critical splice donor site probably null
IGL00563:Vps13a APN 19 16734714 critical splice donor site probably null
IGL00579:Vps13a APN 19 16707362 missense probably benign 0.29
IGL00662:Vps13a APN 19 16704540 missense probably damaging 0.96
IGL00667:Vps13a APN 19 16759676 missense probably damaging 1.00
IGL01102:Vps13a APN 19 16651417 critical splice donor site probably null
IGL01139:Vps13a APN 19 16640625 missense probably damaging 0.99
IGL01142:Vps13a APN 19 16687115 missense possibly damaging 0.86
IGL01361:Vps13a APN 19 16743007 missense probably damaging 1.00
IGL01386:Vps13a APN 19 16701152 missense possibly damaging 0.87
IGL01593:Vps13a APN 19 16762181 missense probably damaging 0.98
IGL01700:Vps13a APN 19 16744857 nonsense probably null
IGL01767:Vps13a APN 19 16663894 missense probably damaging 1.00
IGL01782:Vps13a APN 19 16754337 missense probably damaging 0.98
IGL01808:Vps13a APN 19 16710286 missense probably damaging 1.00
IGL01812:Vps13a APN 19 16715060 missense probably benign
IGL01829:Vps13a APN 19 16619443 missense probably benign 0.01
IGL01893:Vps13a APN 19 16663775 missense probably damaging 1.00
IGL02222:Vps13a APN 19 16682175 missense probably benign 0.06
IGL02295:Vps13a APN 19 16715042 splice site probably benign
IGL02465:Vps13a APN 19 16710941 missense probably benign 0.11
IGL02492:Vps13a APN 19 16647637 missense probably damaging 1.00
IGL02581:Vps13a APN 19 16655322 missense probably benign 0.41
IGL02633:Vps13a APN 19 16720408 missense possibly damaging 0.82
IGL02641:Vps13a APN 19 16698821 missense probably benign 0.01
IGL02659:Vps13a APN 19 16652699 missense probably damaging 1.00
IGL02827:Vps13a APN 19 16641634 missense possibly damaging 0.91
IGL02943:Vps13a APN 19 16663886 missense probably damaging 1.00
IGL03057:Vps13a APN 19 16668694 missense probably damaging 1.00
IGL03077:Vps13a APN 19 16710882 missense probably benign
IGL03184:Vps13a APN 19 16654370 missense probably benign 0.00
eggs UTSW 19 16701165 missense probably damaging 1.00
excambio UTSW 19 16745947 splice site probably null
Faster UTSW 19 16619485 missense probably damaging 1.00
Ham UTSW 19 16677969 missense probably benign 0.08
interchange UTSW 19 16668690 missense probably damaging 1.00
PIT4377001:Vps13a UTSW 19 16740901 missense probably damaging 1.00
R0045:Vps13a UTSW 19 16640810 nonsense probably null
R0045:Vps13a UTSW 19 16640810 nonsense probably null
R0048:Vps13a UTSW 19 16676140 missense probably damaging 1.00
R0062:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R0062:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R0107:Vps13a UTSW 19 16691824 missense probably benign 0.03
R0135:Vps13a UTSW 19 16780765 missense probably damaging 1.00
R0138:Vps13a UTSW 19 16660499 missense possibly damaging 0.95
R0346:Vps13a UTSW 19 16677969 missense probably benign 0.08
R0359:Vps13a UTSW 19 16641577 missense probably damaging 0.99
R0530:Vps13a UTSW 19 16655206 splice site probably benign
R0541:Vps13a UTSW 19 16704577 missense probably benign 0.00
R0614:Vps13a UTSW 19 16652694 missense probably damaging 1.00
R0685:Vps13a UTSW 19 16780741 missense probably damaging 1.00
R0801:Vps13a UTSW 19 16686656 splice site probably benign
R0835:Vps13a UTSW 19 16734882 splice site probably null
R0848:Vps13a UTSW 19 16698897 missense probably damaging 1.00
R1114:Vps13a UTSW 19 16750151 missense probably benign 0.41
R1205:Vps13a UTSW 19 16640541 missense probably damaging 1.00
R1365:Vps13a UTSW 19 16619446 missense probably damaging 1.00
R1445:Vps13a UTSW 19 16701238 nonsense probably null
R1451:Vps13a UTSW 19 16710864 missense probably benign 0.01
R1479:Vps13a UTSW 19 16750114 splice site probably benign
R1533:Vps13a UTSW 19 16701130 nonsense probably null
R1600:Vps13a UTSW 19 16666272 missense probably benign 0.01
R1870:Vps13a UTSW 19 16759952 missense probably damaging 1.00
R1871:Vps13a UTSW 19 16664664 missense probably benign 0.01
R1959:Vps13a UTSW 19 16677938 missense possibly damaging 0.49
R1960:Vps13a UTSW 19 16725631 missense probably damaging 1.00
R1993:Vps13a UTSW 19 16722458 missense probably benign 0.07
R2257:Vps13a UTSW 19 16682174 missense possibly damaging 0.85
R2276:Vps13a UTSW 19 16710426 missense possibly damaging 0.47
R2326:Vps13a UTSW 19 16743057 missense possibly damaging 0.71
R2338:Vps13a UTSW 19 16720453 missense probably damaging 1.00
R2359:Vps13a UTSW 19 16652679 splice site probably benign
R2421:Vps13a UTSW 19 16759671 missense probably benign
R2847:Vps13a UTSW 19 16703599 missense probably damaging 0.98
R3081:Vps13a UTSW 19 16664737 missense probably benign 0.02
R3522:Vps13a UTSW 19 16766493 splice site probably benign
R3613:Vps13a UTSW 19 16685402 missense probably damaging 1.00
R3797:Vps13a UTSW 19 16745947 splice site probably null
R3874:Vps13a UTSW 19 16744953 missense probably benign 0.01
R4032:Vps13a UTSW 19 16616899 missense probably damaging 1.00
R4111:Vps13a UTSW 19 16640628 missense probably damaging 1.00
R4383:Vps13a UTSW 19 16701165 missense probably damaging 1.00
R4504:Vps13a UTSW 19 16695502 missense possibly damaging 0.93
R4578:Vps13a UTSW 19 16682110 missense probably damaging 0.98
R4587:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4588:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4605:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4714:Vps13a UTSW 19 16749856 missense probably benign 0.01
R4756:Vps13a UTSW 19 16655216 missense probably benign 0.01
R4831:Vps13a UTSW 19 16677992 missense probably benign 0.04
R5068:Vps13a UTSW 19 16746058 missense probably benign 0.01
R5070:Vps13a UTSW 19 16654484 missense probably benign
R5082:Vps13a UTSW 19 16744893 missense probably damaging 1.00
R5189:Vps13a UTSW 19 16685315 missense probably damaging 1.00
R5283:Vps13a UTSW 19 16677970 missense probably damaging 0.96
R5294:Vps13a UTSW 19 16641667 missense probably damaging 1.00
R5304:Vps13a UTSW 19 16710387 missense possibly damaging 0.78
R5554:Vps13a UTSW 19 16722411 missense probably damaging 1.00
R5592:Vps13a UTSW 19 16725571 missense probably damaging 1.00
R5611:Vps13a UTSW 19 16725572 missense probably damaging 1.00
R5665:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R5671:Vps13a UTSW 19 16715100 missense probably benign 0.03
R5684:Vps13a UTSW 19 16699045 missense probably benign 0.00
R5767:Vps13a UTSW 19 16664564 missense probably damaging 1.00
R5810:Vps13a UTSW 19 16666324 missense probably benign 0.00
R5866:Vps13a UTSW 19 16680023 missense probably benign 0.04
R5886:Vps13a UTSW 19 16664562 missense probably benign 0.01
R5933:Vps13a UTSW 19 16660530 missense probably benign 0.34
R5965:Vps13a UTSW 19 16619028 splice site probably null
R6259:Vps13a UTSW 19 16687170 nonsense probably null
R6346:Vps13a UTSW 19 16682214 missense possibly damaging 0.94
R6459:Vps13a UTSW 19 16664018 missense possibly damaging 0.56
R6485:Vps13a UTSW 19 16680050 missense probably damaging 0.99
R6520:Vps13a UTSW 19 16725579 missense probably damaging 1.00
R6644:Vps13a UTSW 19 16744919 missense possibly damaging 0.90
R6932:Vps13a UTSW 19 16678075 missense probably benign 0.01
R6934:Vps13a UTSW 19 16676194 missense probably damaging 1.00
R6951:Vps13a UTSW 19 16723740 missense probably benign 0.00
R7027:Vps13a UTSW 19 16664664 missense probably benign 0.01
R7126:Vps13a UTSW 19 16710879 missense probably benign
R7206:Vps13a UTSW 19 16754298 missense probably damaging 1.00
R7248:Vps13a UTSW 19 16678042 missense probably benign 0.25
R7252:Vps13a UTSW 19 16661064 missense probably benign 0.00
R7255:Vps13a UTSW 19 16654339 critical splice donor site probably null
R7382:Vps13a UTSW 19 16619485 missense probably damaging 1.00
R7422:Vps13a UTSW 19 16750173 missense probably damaging 1.00
R7425:Vps13a UTSW 19 16723702 missense probably benign 0.13
R7523:Vps13a UTSW 19 16703789 missense probably benign
R7586:Vps13a UTSW 19 16647598 missense probably benign 0.08
R7587:Vps13a UTSW 19 16703789 missense probably benign 0.00
R7593:Vps13a UTSW 19 16725663 missense probably damaging 1.00
R7637:Vps13a UTSW 19 16750149 missense probably benign 0.02
R7763:Vps13a UTSW 19 16746000 missense possibly damaging 0.95
R7813:Vps13a UTSW 19 16651456 missense possibly damaging 0.81
R7815:Vps13a UTSW 19 16725572 missense probably damaging 1.00
R7861:Vps13a UTSW 19 16655304 missense probably damaging 1.00
R7909:Vps13a UTSW 19 16720430 nonsense probably null
R7939:Vps13a UTSW 19 16740791 missense possibly damaging 0.94
R8108:Vps13a UTSW 19 16640787 missense probably damaging 1.00
R8123:Vps13a UTSW 19 16647702 missense probably benign 0.01
R8134:Vps13a UTSW 19 16654354 missense possibly damaging 0.71
R8168:Vps13a UTSW 19 16749548 missense probably benign 0.09
R8272:Vps13a UTSW 19 16749845 critical splice donor site probably null
R8293:Vps13a UTSW 19 16668605 missense possibly damaging 0.81
R8303:Vps13a UTSW 19 16616906 missense probably benign 0.00
R8383:Vps13a UTSW 19 16723705 missense possibly damaging 0.83
R8386:Vps13a UTSW 19 16701119 critical splice donor site probably null
R8433:Vps13a UTSW 19 16741236 missense possibly damaging 0.56
R8436:Vps13a UTSW 19 16740793 missense probably benign 0.10
R8450:Vps13a UTSW 19 16654507 splice site probably null
R8476:Vps13a UTSW 19 16722457 missense possibly damaging 0.60
R8501:Vps13a UTSW 19 16682120 missense probably benign 0.39
R8552:Vps13a UTSW 19 16754320 missense probably damaging 0.99
R8680:Vps13a UTSW 19 16645906 missense possibly damaging 0.84
R8784:Vps13a UTSW 19 16664789 missense probably damaging 1.00
R8871:Vps13a UTSW 19 16663822 missense probably damaging 1.00
R8945:Vps13a UTSW 19 16664750 missense probably damaging 1.00
R8948:Vps13a UTSW 19 16745976 missense probably damaging 0.99
R8950:Vps13a UTSW 19 16745976 missense probably damaging 0.99
R8960:Vps13a UTSW 19 16705883 missense possibly damaging 0.67
X0061:Vps13a UTSW 19 16645868 missense probably benign 0.40
X0066:Vps13a UTSW 19 16742553 missense probably benign 0.33
Z1177:Vps13a UTSW 19 16699113 critical splice acceptor site probably null
Z31818:Vps13a UTSW 19 16780754 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGGCACTCAAATATCTGATTGAG -3'
(R):5'- ACACAAAAGTTGCCAGTGTC -3'

Sequencing Primer
(F):5'- TGATTGAGAAAGAACAGAGAACATTC -3'
(R):5'- GCCAGTGTCTCCTATTTAATAAAGAC -3'
Posted On2016-07-06