Mutagenetix > Incidental Mutations

Incidental Mutation 'R5183:Orc2'

397646

Institutional Source

Beutler Lab

Gene Symbol

Orc2

Ensembl Gene

ENSMUSG00000026037

Gene Name

origin recognition complex, subunit 2

Synonyms

Orc2l

MMRRC Submission

042762-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R5183 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58462771-58505109 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58474818 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 298 (S298R)

Ref Sequence

ENSEMBL: ENSMUSP00000109964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027198] [ENSMUST00000114325] [ENSMUST00000114337]

Predicted Effect

probably benign
Transcript: ENSMUST00000027198
AA Change: S346R

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000027198
Gene: ENSMUSG00000026037
AA Change: S346R

Domain	Start	End	E-Value	Type
low complexity region	176	201	N/A	INTRINSIC
Pfam:ORC2	254	563	2.5e-110	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114325
AA Change: S298R

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109964
Gene: ENSMUSG00000026037
AA Change: S298R

Domain	Start	End	E-Value	Type
low complexity region	128	153	N/A	INTRINSIC
Pfam:ORC2	206	517	1.2e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114337

SMART Domains

Protein: ENSMUSP00000109976
Gene: ENSMUSG00000026036

Domain	Start	End	E-Value	Type
Pfam:NIF3	31	324	4e-61	PFAM

Meta Mutation Damage Score

0.1137

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. This protein forms a core complex with ORC3, -4, and -5. It also interacts with CDC45 and MCM10, which are proteins known to be important for the initiation of DNA replication. This protein has been demonstrated to specifically associate with the origin of replication of Epstein-Barr virus in human cells, and is thought to be required for DNA replication from viral origin of replication. Alternatively spliced transcript variants have been found, one of which is a nonsense-mediated mRNA decay candidate. [provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,739,305	D8E	probably damaging	Het
Abca3	T	G	17: 24,374,453	S275A	probably benign	Het
Adk	A	G	14: 21,240,531	N155S	probably damaging	Het
Aqp11	T	C	7: 97,737,756	T78A	probably benign	Het
Arhgef40	T	C	14: 52,004,099	V1455A	probably damaging	Het
Asxl3	C	G	18: 22,525,299	A2122G	possibly damaging	Het
Cdan1	T	A	2: 120,729,580	I368F	probably damaging	Het
Cdc42bpg	A	G	19: 6,321,805		probably benign	Het
Celsr3	A	G	9: 108,837,560	D2013G	probably damaging	Het
Cep152	A	G	2: 125,566,638	V1332A	probably damaging	Het
Cftr	T	C	6: 18,299,833	S1172P	probably damaging	Het
Commd2	A	T	3: 57,646,814	D155E	probably benign	Het
Coq7	T	A	7: 118,528,267		probably benign	Het
Dnase2a	T	C	8: 84,909,578		probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Dock6	C	T	9: 21,841,603	V305I	probably benign	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Fasn	T	C	11: 120,808,882	Q2288R	probably benign	Het
Fat3	T	A	9: 15,960,313	N3594I	probably damaging	Het
Galnt10	T	C	11: 57,769,588	M284T	probably damaging	Het
Gatm	A	T	2: 122,595,503	F422L	probably benign	Het
Glrp1	A	T	1: 88,509,852	I12N	unknown	Het
Gm5455	T	A	13: 110,305,428		noncoding transcript	Het
Gm6768	A	C	12: 119,261,288		noncoding transcript	Het
Gm884	T	C	11: 103,543,121	Y898C	probably damaging	Het
Gpam	C	T	19: 55,083,227	E361K	probably damaging	Het
Gps2	A	G	11: 69,915,197	T126A	probably benign	Het
Grn	C	A	11: 102,430,554		probably benign	Het
Gsg1	T	A	6: 135,241,370	Q176L	probably damaging	Het
Htra1	C	T	7: 130,983,716	A412V	possibly damaging	Het
Icosl	C	T	10: 78,069,485		probably benign	Het
Iqgap1	T	C	7: 80,723,065	T1509A	probably damaging	Het
Itgad	T	C	7: 128,198,223		probably null	Het
Kdm5a	C	A	6: 120,430,016		probably benign	Het
Kidins220	T	C	12: 25,051,126	L1017S	probably benign	Het
Lrmp	A	G	6: 145,138,220	E37G	probably benign	Het
Man2b1	T	A	8: 85,095,784	S804R	probably damaging	Het
Miip	A	T	4: 147,863,069	F211L	probably damaging	Het
Moxd1	T	G	10: 24,287,136	Y499D	probably damaging	Het
Moxd1	T	G	10: 24,279,547		probably null	Het
Mrpl45	T	C	11: 97,316,751	I24T	probably benign	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Mthfr	T	A	4: 148,051,360		probably null	Het
Muc5b	T	A	7: 141,850,810	D827E	unknown	Het
Myo1g	G	C	11: 6,508,243	L866V	probably damaging	Het
Myo3a	A	T	2: 22,578,158	M475L	probably benign	Het
Ncoa2	A	C	1: 13,174,366	L703V	probably damaging	Het
Nme6	T	A	9: 109,841,489	Y69*	probably null	Het
Nwd1	T	A	8: 72,671,086	M651K	probably benign	Het
Olfr726	A	C	14: 50,084,546	I45S	probably damaging	Het
Oscp1	A	T	4: 126,087,729	E328V	probably damaging	Het
Pan2	T	C	10: 128,317,969	V1003A	probably damaging	Het
Pik3r4	T	C	9: 105,682,308	V1200A	possibly damaging	Het
Prl	T	C	13: 27,057,596		probably benign	Het
Ptprk	T	C	10: 28,475,236	V575A	probably benign	Het
Rflna	A	T	5: 125,011,405	S139C	probably damaging	Het
Robo1	T	C	16: 72,742,150	F27S	probably benign	Het
Secisbp2	T	C	13: 51,665,424	S347P	probably benign	Het
Shmt1	A	G	11: 60,797,482		probably benign	Het
Slc27a3	A	G	3: 90,389,170		probably null	Het
Slc6a5	T	C	7: 49,936,209	V425A	probably damaging	Het
Slc8a3	A	G	12: 81,314,491	V518A	possibly damaging	Het
Slco1a4	A	T	6: 141,839,631	Y78N	probably damaging	Het
Stt3b	A	T	9: 115,266,143	H273Q	probably damaging	Het
Tle6	T	A	10: 81,592,801	N431I	probably damaging	Het
Trim34b	C	A	7: 104,329,911	Q122K	possibly damaging	Het
Trio	C	A	15: 27,902,600	R258S	probably benign	Het
Ttc7	A	T	17: 87,292,878	D23V	probably damaging	Het
Ttn	A	T	2: 76,980,181	M1K	probably null	Het
Ufsp2	T	C	8: 45,994,089	V391A	probably benign	Het
Vps13c	T	C	9: 67,908,052	L990S	probably damaging	Het
Zfp108	G	T	7: 24,260,738	K251N	probably benign	Het
Zfp618	G	A	4: 63,099,282	M234I	probably benign	Het

Other mutations in Orc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Orc2	APN	1	58493716	missense	possibly damaging	0.81
IGL00549:Orc2	APN	1	58481042	missense	probably benign	0.00
IGL01343:Orc2	APN	1	58492855	critical splice donor site	probably null
IGL01357:Orc2	APN	1	58497392	missense	probably benign	0.26
IGL01357:Orc2	APN	1	58497393	missense	probably benign	0.00
IGL02167:Orc2	APN	1	58483639	unclassified	probably benign
IGL02343:Orc2	APN	1	58469666	critical splice donor site	probably null
IGL02548:Orc2	APN	1	58466122	unclassified	probably benign
R0557:Orc2	UTSW	1	58469687	missense	probably damaging	1.00
R1470:Orc2	UTSW	1	58481158	unclassified	probably benign
R1886:Orc2	UTSW	1	58471088	critical splice acceptor site	probably null
R2065:Orc2	UTSW	1	58469695	missense	probably damaging	1.00
R3848:Orc2	UTSW	1	58480992	missense	probably benign	0.08
R4389:Orc2	UTSW	1	58474861	missense	probably benign	0.21
R4393:Orc2	UTSW	1	58467650	critical splice donor site	probably null
R4613:Orc2	UTSW	1	58500309	nonsense	probably null
R5652:Orc2	UTSW	1	58466072	missense	probably damaging	0.99
R5793:Orc2	UTSW	1	58497388	start codon destroyed	probably null	0.27
R5997:Orc2	UTSW	1	58472388	missense	probably damaging	1.00
R6007:Orc2	UTSW	1	58467692	missense	probably benign	0.03
R6330:Orc2	UTSW	1	58500334	missense	probably benign
R6656:Orc2	UTSW	1	58493659	critical splice donor site	probably null
R6923:Orc2	UTSW	1	58500375	missense	probably benign	0.01
R6934:Orc2	UTSW	1	58500364	missense	probably benign	0.28
R7354:Orc2	UTSW	1	58469747	missense	possibly damaging	0.96
R7718:Orc2	UTSW	1	58480317	missense	possibly damaging	0.65
R7950:Orc2	UTSW	1	58467668	missense	possibly damaging	0.64
Z1088:Orc2	UTSW	1	58476516	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGTGACTTGGTAGGAAATTCAAAC -3'
(R):5'- GTCCTTGTGAGCTGGAAAGAAAC -3'

Sequencing Primer
(F):5'- TTGGTAGGAAATTCAAACATGAAAAC -3'
(R):5'- TAAAGCTGGCAGTCAGGAGTCTC -3'

Posted On

2016-07-06