Incidental Mutation 'R5183:Miip'
ID 397657
Institutional Source Beutler Lab
Gene Symbol Miip
Ensembl Gene ENSMUSG00000029022
Gene Name migration and invasion inhibitory protein
Synonyms D4Wsu114e
MMRRC Submission 042762-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R5183 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 147945235-147953176 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 147947526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 211 (F211L)
Ref Sequence ENSEMBL: ENSMUSP00000134085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000119975] [ENSMUST00000172710]
AlphaFold A2A7Y5
Predicted Effect probably damaging
Transcript: ENSMUST00000030886
AA Change: F211L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022
AA Change: F211L

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119975
AA Change: F211L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022
AA Change: F211L

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:MIIP 41 382 1.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156374
Predicted Effect probably damaging
Transcript: ENSMUST00000172710
AA Change: F211L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022
AA Change: F211L

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174081
Meta Mutation Damage Score 0.3099 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,887,171 (GRCm39) D8E probably damaging Het
Abca3 T G 17: 24,593,427 (GRCm39) S275A probably benign Het
Adk A G 14: 21,290,599 (GRCm39) N155S probably damaging Het
Aqp11 T C 7: 97,386,963 (GRCm39) T78A probably benign Het
Arhgef40 T C 14: 52,241,556 (GRCm39) V1455A probably damaging Het
Asxl3 C G 18: 22,658,356 (GRCm39) A2122G possibly damaging Het
Cdan1 T A 2: 120,560,061 (GRCm39) I368F probably damaging Het
Cdc42bpg A G 19: 6,371,835 (GRCm39) probably benign Het
Celsr3 A G 9: 108,714,759 (GRCm39) D2013G probably damaging Het
Cep152 A G 2: 125,408,558 (GRCm39) V1332A probably damaging Het
Cftr T C 6: 18,299,832 (GRCm39) S1172P probably damaging Het
Commd2 A T 3: 57,554,235 (GRCm39) D155E probably benign Het
Coq7 T A 7: 118,127,490 (GRCm39) probably benign Het
Dnase2a T C 8: 85,636,207 (GRCm39) probably benign Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Dock6 C T 9: 21,752,899 (GRCm39) V305I probably benign Het
Ehmt1 G T 2: 24,767,509 (GRCm39) P135T probably damaging Het
Fasn T C 11: 120,699,708 (GRCm39) Q2288R probably benign Het
Fat3 T A 9: 15,871,609 (GRCm39) N3594I probably damaging Het
Galnt10 T C 11: 57,660,414 (GRCm39) M284T probably damaging Het
Gatm A T 2: 122,425,984 (GRCm39) F422L probably benign Het
Glrp1 A T 1: 88,437,574 (GRCm39) I12N unknown Het
Gm5455 T A 13: 110,441,962 (GRCm39) noncoding transcript Het
Gpam C T 19: 55,071,659 (GRCm39) E361K probably damaging Het
Gps2 A G 11: 69,806,023 (GRCm39) T126A probably benign Het
Grn C A 11: 102,321,380 (GRCm39) probably benign Het
Gsg1 T A 6: 135,218,368 (GRCm39) Q176L probably damaging Het
Htra1 C T 7: 130,585,446 (GRCm39) A412V possibly damaging Het
Icosl C T 10: 77,905,319 (GRCm39) probably benign Het
Iqgap1 T C 7: 80,372,813 (GRCm39) T1509A probably damaging Het
Irag2 A G 6: 145,083,946 (GRCm39) E37G probably benign Het
Itgad T C 7: 127,797,395 (GRCm39) probably null Het
Kdm5a C A 6: 120,406,977 (GRCm39) probably benign Het
Kidins220 T C 12: 25,101,125 (GRCm39) L1017S probably benign Het
Lrrc37 T C 11: 103,433,947 (GRCm39) Y898C probably damaging Het
Man2b1 T A 8: 85,822,413 (GRCm39) S804R probably damaging Het
Moxd1 T G 10: 24,155,445 (GRCm39) probably null Het
Moxd1 T G 10: 24,163,034 (GRCm39) Y499D probably damaging Het
Mrpl45 T C 11: 97,207,577 (GRCm39) I24T probably benign Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Mthfr T A 4: 148,135,817 (GRCm39) probably null Het
Muc5b T A 7: 141,404,547 (GRCm39) D827E unknown Het
Myo1g G C 11: 6,458,243 (GRCm39) L866V probably damaging Het
Myo3a A T 2: 22,468,170 (GRCm39) M475L probably benign Het
Ncoa2 A C 1: 13,244,590 (GRCm39) L703V probably damaging Het
Ncoa4-ps A C 12: 119,225,023 (GRCm39) noncoding transcript Het
Nme6 T A 9: 109,670,557 (GRCm39) Y69* probably null Het
Nwd1 T A 8: 73,397,714 (GRCm39) M651K probably benign Het
Or4k15c A C 14: 50,322,003 (GRCm39) I45S probably damaging Het
Orc2 A T 1: 58,513,977 (GRCm39) S298R possibly damaging Het
Oscp1 A T 4: 125,981,522 (GRCm39) E328V probably damaging Het
Pan2 T C 10: 128,153,838 (GRCm39) V1003A probably damaging Het
Pik3r4 T C 9: 105,559,507 (GRCm39) V1200A possibly damaging Het
Prl T C 13: 27,241,579 (GRCm39) probably benign Het
Ptprk T C 10: 28,351,232 (GRCm39) V575A probably benign Het
Rflna A T 5: 125,088,469 (GRCm39) S139C probably damaging Het
Robo1 T C 16: 72,539,038 (GRCm39) F27S probably benign Het
Secisbp2 T C 13: 51,819,460 (GRCm39) S347P probably benign Het
Shmt1 A G 11: 60,688,308 (GRCm39) probably benign Het
Slc27a3 A G 3: 90,296,477 (GRCm39) probably null Het
Slc6a5 T C 7: 49,585,957 (GRCm39) V425A probably damaging Het
Slc8a3 A G 12: 81,361,265 (GRCm39) V518A possibly damaging Het
Slco1a4 A T 6: 141,785,357 (GRCm39) Y78N probably damaging Het
Stt3b A T 9: 115,095,211 (GRCm39) H273Q probably damaging Het
Tle6 T A 10: 81,428,635 (GRCm39) N431I probably damaging Het
Trim34b C A 7: 103,979,118 (GRCm39) Q122K possibly damaging Het
Trio C A 15: 27,902,686 (GRCm39) R258S probably benign Het
Ttc7 A T 17: 87,600,306 (GRCm39) D23V probably damaging Het
Ttn A T 2: 76,810,525 (GRCm39) M1K probably null Het
Ufsp2 T C 8: 46,447,126 (GRCm39) V391A probably benign Het
Vps13c T C 9: 67,815,334 (GRCm39) L990S probably damaging Het
Zfp108 G T 7: 23,960,163 (GRCm39) K251N probably benign Het
Zfp618 G A 4: 63,017,519 (GRCm39) M234I probably benign Het
Other mutations in Miip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Miip APN 4 147,950,322 (GRCm39) missense probably damaging 1.00
IGL02134:Miip APN 4 147,949,735 (GRCm39) splice site probably benign
IGL02829:Miip APN 4 147,947,518 (GRCm39) missense probably benign 0.01
IGL03350:Miip APN 4 147,946,979 (GRCm39) missense probably benign 0.01
R0200:Miip UTSW 4 147,946,720 (GRCm39) missense probably damaging 0.99
R1647:Miip UTSW 4 147,949,691 (GRCm39) missense probably benign 0.02
R1783:Miip UTSW 4 147,950,231 (GRCm39) missense probably damaging 1.00
R1848:Miip UTSW 4 147,947,549 (GRCm39) missense probably damaging 0.99
R1944:Miip UTSW 4 147,950,422 (GRCm39) missense probably benign 0.15
R3615:Miip UTSW 4 147,950,371 (GRCm39) missense probably benign 0.00
R3616:Miip UTSW 4 147,950,371 (GRCm39) missense probably benign 0.00
R3882:Miip UTSW 4 147,945,509 (GRCm39) missense possibly damaging 0.93
R4579:Miip UTSW 4 147,945,518 (GRCm39) missense probably damaging 1.00
R6054:Miip UTSW 4 147,950,135 (GRCm39) missense probably benign 0.00
R6056:Miip UTSW 4 147,946,792 (GRCm39) missense probably damaging 1.00
R6304:Miip UTSW 4 147,947,540 (GRCm39) missense probably benign 0.12
R6568:Miip UTSW 4 147,950,372 (GRCm39) missense probably benign
R6603:Miip UTSW 4 147,950,380 (GRCm39) missense possibly damaging 0.92
R7639:Miip UTSW 4 147,947,021 (GRCm39) missense probably benign 0.22
R7701:Miip UTSW 4 147,947,371 (GRCm39) missense probably null 0.86
R7795:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7796:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7797:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7872:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7920:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R8468:Miip UTSW 4 147,945,928 (GRCm39) missense probably damaging 1.00
R8492:Miip UTSW 4 147,945,881 (GRCm39) missense probably damaging 1.00
R8677:Miip UTSW 4 147,947,503 (GRCm39) missense probably damaging 1.00
R8852:Miip UTSW 4 147,950,839 (GRCm39) start gained probably benign
R8860:Miip UTSW 4 147,950,839 (GRCm39) start gained probably benign
R9755:Miip UTSW 4 147,950,319 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAAGTGGACACTCACACTC -3'
(R):5'- TTAAGGACTCTGTGGGAATCCAG -3'

Sequencing Primer
(F):5'- TGGACACTCACACTCGTGGTC -3'
(R):5'- CTGTGGACTGCTGACTACAG -3'
Posted On 2016-07-06