Mutagenetix > Incidental Mutations

Incidental Mutation 'R5183:Kdm5a'

397662

Institutional Source

Beutler Lab

Gene Symbol

Kdm5a

Ensembl Gene

ENSMUSG00000030180

Gene Name

lysine (K)-specific demethylase 5A

Synonyms

Jarid1a, Rbbp2, RBP2

MMRRC Submission

042762-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5183 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120364124-120444574 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to A at 120430016 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000005108 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005108]

Predicted Effect

probably benign
Transcript: ENSMUST00000005108

SMART Domains

Protein: ENSMUSP00000005108
Gene: ENSMUSG00000030180

Domain	Start	End	E-Value	Type
JmjN	18	59	4.06e-20	SMART
ARID	81	170	4.76e-35	SMART
BRIGHT	85	175	2.48e-31	SMART
PHD	295	341	1.16e-14	SMART
Blast:JmjC	384	436	2e-22	BLAST
JmjC	437	603	5.88e-73	SMART
low complexity region	638	651	N/A	INTRINSIC
Pfam:zf-C5HC2	676	729	1.3e-21	PFAM
Pfam:PLU-1	740	1072	1.2e-104	PFAM
low complexity region	1091	1119	N/A	INTRINSIC
PHD	1163	1216	1.37e-11	SMART
low complexity region	1269	1280	N/A	INTRINSIC
low complexity region	1337	1351	N/A	INTRINSIC
low complexity region	1403	1414	N/A	INTRINSIC
low complexity region	1494	1512	N/A	INTRINSIC
coiled coil region	1534	1579	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124525

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132599

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142791

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Jumonji, AT-rich interactive domain 1 (JARID1) histone demethylase protein family. The encoded protein plays a role in gene regulation through the histone code by specifically demethylating lysine 4 of histone H3. The encoded protein interacts with many other proteins, including retinoblastoma protein, and is implicated in the transcriptional regulation of Hox genes and cytokines. This gene may play a role in tumor progression. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, abnormal involuntary movement and quantitative changes in the hematopoietic stem cell and myeloid progenitor compartments, consistent with enhanced survival and increased cycling. Neonatalsurvival is sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,739,305	D8E	probably damaging	Het
Abca3	T	G	17: 24,374,453	S275A	probably benign	Het
Adk	A	G	14: 21,240,531	N155S	probably damaging	Het
Aqp11	T	C	7: 97,737,756	T78A	probably benign	Het
Arhgef40	T	C	14: 52,004,099	V1455A	probably damaging	Het
Asxl3	C	G	18: 22,525,299	A2122G	possibly damaging	Het
Cdan1	T	A	2: 120,729,580	I368F	probably damaging	Het
Cdc42bpg	A	G	19: 6,321,805		probably benign	Het
Celsr3	A	G	9: 108,837,560	D2013G	probably damaging	Het
Cep152	A	G	2: 125,566,638	V1332A	probably damaging	Het
Cftr	T	C	6: 18,299,833	S1172P	probably damaging	Het
Commd2	A	T	3: 57,646,814	D155E	probably benign	Het
Coq7	T	A	7: 118,528,267		probably benign	Het
Dnase2a	T	C	8: 84,909,578		probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Dock6	C	T	9: 21,841,603	V305I	probably benign	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Fasn	T	C	11: 120,808,882	Q2288R	probably benign	Het
Fat3	T	A	9: 15,960,313	N3594I	probably damaging	Het
Galnt10	T	C	11: 57,769,588	M284T	probably damaging	Het
Gatm	A	T	2: 122,595,503	F422L	probably benign	Het
Glrp1	A	T	1: 88,509,852	I12N	unknown	Het
Gm5455	T	A	13: 110,305,428		noncoding transcript	Het
Gm6768	A	C	12: 119,261,288		noncoding transcript	Het
Gm884	T	C	11: 103,543,121	Y898C	probably damaging	Het
Gpam	C	T	19: 55,083,227	E361K	probably damaging	Het
Gps2	A	G	11: 69,915,197	T126A	probably benign	Het
Grn	C	A	11: 102,430,554		probably benign	Het
Gsg1	T	A	6: 135,241,370	Q176L	probably damaging	Het
Htra1	C	T	7: 130,983,716	A412V	possibly damaging	Het
Icosl	C	T	10: 78,069,485		probably benign	Het
Iqgap1	T	C	7: 80,723,065	T1509A	probably damaging	Het
Itgad	T	C	7: 128,198,223		probably null	Het
Kidins220	T	C	12: 25,051,126	L1017S	probably benign	Het
Lrmp	A	G	6: 145,138,220	E37G	probably benign	Het
Man2b1	T	A	8: 85,095,784	S804R	probably damaging	Het
Miip	A	T	4: 147,863,069	F211L	probably damaging	Het
Moxd1	T	G	10: 24,279,547		probably null	Het
Moxd1	T	G	10: 24,287,136	Y499D	probably damaging	Het
Mrpl45	T	C	11: 97,316,751	I24T	probably benign	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Mthfr	T	A	4: 148,051,360		probably null	Het
Muc5b	T	A	7: 141,850,810	D827E	unknown	Het
Myo1g	G	C	11: 6,508,243	L866V	probably damaging	Het
Myo3a	A	T	2: 22,578,158	M475L	probably benign	Het
Ncoa2	A	C	1: 13,174,366	L703V	probably damaging	Het
Nme6	T	A	9: 109,841,489	Y69*	probably null	Het
Nwd1	T	A	8: 72,671,086	M651K	probably benign	Het
Olfr726	A	C	14: 50,084,546	I45S	probably damaging	Het
Orc2	A	T	1: 58,474,818	S298R	possibly damaging	Het
Oscp1	A	T	4: 126,087,729	E328V	probably damaging	Het
Pan2	T	C	10: 128,317,969	V1003A	probably damaging	Het
Pik3r4	T	C	9: 105,682,308	V1200A	possibly damaging	Het
Prl	T	C	13: 27,057,596		probably benign	Het
Ptprk	T	C	10: 28,475,236	V575A	probably benign	Het
Rflna	A	T	5: 125,011,405	S139C	probably damaging	Het
Robo1	T	C	16: 72,742,150	F27S	probably benign	Het
Secisbp2	T	C	13: 51,665,424	S347P	probably benign	Het
Shmt1	A	G	11: 60,797,482		probably benign	Het
Slc27a3	A	G	3: 90,389,170		probably null	Het
Slc6a5	T	C	7: 49,936,209	V425A	probably damaging	Het
Slc8a3	A	G	12: 81,314,491	V518A	possibly damaging	Het
Slco1a4	A	T	6: 141,839,631	Y78N	probably damaging	Het
Stt3b	A	T	9: 115,266,143	H273Q	probably damaging	Het
Tle6	T	A	10: 81,592,801	N431I	probably damaging	Het
Trim34b	C	A	7: 104,329,911	Q122K	possibly damaging	Het
Trio	C	A	15: 27,902,600	R258S	probably benign	Het
Ttc7	A	T	17: 87,292,878	D23V	probably damaging	Het
Ttn	A	T	2: 76,980,181	M1K	probably null	Het
Ufsp2	T	C	8: 45,994,089	V391A	probably benign	Het
Vps13c	T	C	9: 67,908,052	L990S	probably damaging	Het
Zfp108	G	T	7: 24,260,738	K251N	probably benign	Het
Zfp618	G	A	4: 63,099,282	M234I	probably benign	Het

Other mutations in Kdm5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Kdm5a	APN	6	120385719	critical splice donor site	probably null	0.00
IGL00706:Kdm5a	APN	6	120406636	missense	possibly damaging	0.44
IGL01361:Kdm5a	APN	6	120399016	missense	probably damaging	1.00
IGL01402:Kdm5a	APN	6	120390679	nonsense	probably null	0.00
IGL01924:Kdm5a	APN	6	120394255	critical splice donor site	probably null	0.00
IGL01935:Kdm5a	APN	6	120408323	missense	probably benign	0.02
IGL02165:Kdm5a	APN	6	120415290	missense	probably damaging	1.00
IGL02472:Kdm5a	APN	6	120406730	splice site	probably benign
IGL02506:Kdm5a	APN	6	120432149	missense	probably damaging	0.99
IGL02604:Kdm5a	APN	6	120431980	missense	probably benign
IGL02633:Kdm5a	APN	6	120364719	missense	probably damaging	1.00
IGL02876:Kdm5a	APN	6	120390644	unclassified	probably benign
IGL03009:Kdm5a	APN	6	120430086	missense	probably damaging	0.98
IGL03027:Kdm5a	APN	6	120374990	splice site	probably null
IGL03164:Kdm5a	APN	6	120439019	missense	probably damaging	1.00
IGL03236:Kdm5a	APN	6	120438988	missense	probably damaging	0.98
IGL03276:Kdm5a	APN	6	120402708	splice site	probably benign
Augmented	UTSW	6	120430016	intron	probably benign
Calla_lily	UTSW	6	120405022	missense	probably damaging	1.00
crocus	UTSW	6	120399038	missense	probably null	0.98
Magnolia	UTSW	6	120398978	missense	probably damaging	0.99
Selbst	UTSW	6	120388105	nonsense	probably null
R0320:Kdm5a	UTSW	6	120389620	missense	probably benign	0.19
R0462:Kdm5a	UTSW	6	120402600	missense	probably damaging	1.00
R0601:Kdm5a	UTSW	6	120402671	missense	possibly damaging	0.76
R0628:Kdm5a	UTSW	6	120415239	missense	probably damaging	1.00
R1024:Kdm5a	UTSW	6	120399038	missense	probably null	0.98
R2013:Kdm5a	UTSW	6	120431990	missense	probably benign	0.09
R2015:Kdm5a	UTSW	6	120431990	missense	probably benign	0.09
R2061:Kdm5a	UTSW	6	120381617	missense	probably benign
R2188:Kdm5a	UTSW	6	120406640	missense	possibly damaging	0.59
R3923:Kdm5a	UTSW	6	120381664	missense	probably benign	0.01
R4013:Kdm5a	UTSW	6	120394106	missense	probably damaging	1.00
R4016:Kdm5a	UTSW	6	120394106	missense	probably damaging	1.00
R4017:Kdm5a	UTSW	6	120394106	missense	probably damaging	1.00
R4030:Kdm5a	UTSW	6	120405113	nonsense	probably null
R4646:Kdm5a	UTSW	6	120374977	missense	possibly damaging	0.55
R4737:Kdm5a	UTSW	6	120406015	intron	probably benign
R4779:Kdm5a	UTSW	6	120369099	unclassified	probably benign
R4836:Kdm5a	UTSW	6	120412402	missense	probably damaging	1.00
R5129:Kdm5a	UTSW	6	120405022	missense	probably damaging	1.00
R5182:Kdm5a	UTSW	6	120388105	nonsense	probably null
R5572:Kdm5a	UTSW	6	120412375	missense	possibly damaging	0.69
R6110:Kdm5a	UTSW	6	120412306	missense	probably damaging	1.00
R6132:Kdm5a	UTSW	6	120374931	missense	probably damaging	1.00
R6198:Kdm5a	UTSW	6	120438997	missense	probably benign	0.37
R6246:Kdm5a	UTSW	6	120431910	missense	probably damaging	0.97
R6336:Kdm5a	UTSW	6	120398978	missense	probably damaging	0.99
R6343:Kdm5a	UTSW	6	120382933	missense	probably benign	0.01
R6612:Kdm5a	UTSW	6	120430228	missense	probably damaging	0.99
R6647:Kdm5a	UTSW	6	120412461	missense	probably benign	0.25
R7068:Kdm5a	UTSW	6	120430215	missense	probably benign	0.40
R7369:Kdm5a	UTSW	6	120432004	missense	possibly damaging	0.67
R7380:Kdm5a	UTSW	6	120405918	missense	probably benign	0.35
R7411:Kdm5a	UTSW	6	120426815	missense	probably damaging	1.00
R7521:Kdm5a	UTSW	6	120432187	nonsense	probably null
R7570:Kdm5a	UTSW	6	120427842	missense	probably damaging	0.99
R7647:Kdm5a	UTSW	6	120427786	missense	probably benign	0.01
R7704:Kdm5a	UTSW	6	120427064	missense	probably damaging	1.00
R7796:Kdm5a	UTSW	6	120390763	missense	probably damaging	1.00
R7875:Kdm5a	UTSW	6	120399018	nonsense	probably null
R8265:Kdm5a	UTSW	6	120406596	missense	possibly damaging	0.72
R8297:Kdm5a	UTSW	6	120381555	missense	probably benign	0.00
R8336:Kdm5a	UTSW	6	120419446	missense	probably benign	0.00
R8471:Kdm5a	UTSW	6	120430231	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGGGAGAGGTACATTTCTTTC -3'
(R):5'- AGAGACACTTCTAGGAGGTCTC -3'

Sequencing Primer
(F):5'- AGTACACTGTAGCTGTCTTCAGAC -3'
(R):5'- CCAACCATCATGAGTTCTTCCAACTG -3'

Posted On

2016-07-06