Mutagenetix > Incidental Mutation

Incidental Mutation 'R5183:Celsr3'

397683

Institutional Source

Beutler Lab

Gene Symbol

Celsr3

Ensembl Gene

ENSMUSG00000023473

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 3

Synonyms

Fmi1, flamingo

MMRRC Submission

042762-MU

Accession Numbers

Genbank: NM_080437; MGI: 1858236

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5183 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108826320-108852969 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108837560 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 2013 (D2013G)

Ref Sequence

ENSEMBL: ENSMUSP00000024238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000192235] [ENSMUST00000213524]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000024238
AA Change: D2013G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: D2013G

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	264	293	N/A	INTRINSIC
CA	338	422	2.25e-27	SMART
CA	446	534	5.05e-30	SMART
CA	558	640	7.6e-25	SMART
CA	664	745	7.36e-32	SMART
CA	769	847	5.95e-18	SMART
CA	871	950	5.25e-28	SMART
CA	974	1056	2.67e-29	SMART
CA	1080	1158	1.18e-21	SMART
CA	1186	1262	3.2e-1	SMART
low complexity region	1328	1335	N/A	INTRINSIC
low complexity region	1350	1360	N/A	INTRINSIC
EGF	1369	1424	1.02e-2	SMART
EGF	1429	1464	3.23e0	SMART
EGF	1467	1503	8.78e-2	SMART
LamG	1524	1691	2.27e-35	SMART
EGF	1714	1747	4.22e-4	SMART
LamG	1774	1913	9.02e-21	SMART
EGF	1938	1971	2.43e-4	SMART
EGF	1973	2009	1.3e-4	SMART
EGF_Lam	2066	2111	5.08e-7	SMART
HormR	2114	2176	3.42e-21	SMART
Pfam:GAIN	2188	2441	1.1e-57	PFAM
GPS	2467	2520	7.92e-20	SMART
Pfam:7tm_2	2527	2758	1.5e-56	PFAM
low complexity region	2813	2829	N/A	INTRINSIC
low complexity region	2882	2906	N/A	INTRINSIC
low complexity region	3058	3072	N/A	INTRINSIC
low complexity region	3149	3189	N/A	INTRINSIC
low complexity region	3239	3261	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192235

SMART Domains

Protein: ENSMUSP00000141429
Gene: ENSMUSG00000023473

Domain	Start	End	E-Value	Type
low complexity region	67	74	N/A	INTRINSIC
low complexity region	89	99	N/A	INTRINSIC
EGF	108	163	4.9e-5	SMART
EGF	168	201	2.6e-6	SMART
EGF_like	208	239	1.6e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193726

Predicted Effect

probably damaging
Transcript: ENSMUST00000213524
AA Change: D2015G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

Meta Mutation Damage Score

0.2293

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,739,305	D8E	probably damaging	Het
Abca3	T	G	17: 24,374,453	S275A	probably benign	Het
Adk	A	G	14: 21,240,531	N155S	probably damaging	Het
Aqp11	T	C	7: 97,737,756	T78A	probably benign	Het
Arhgef40	T	C	14: 52,004,099	V1455A	probably damaging	Het
Asxl3	C	G	18: 22,525,299	A2122G	possibly damaging	Het
Cdan1	T	A	2: 120,729,580	I368F	probably damaging	Het
Cdc42bpg	A	G	19: 6,321,805		probably benign	Het
Cep152	A	G	2: 125,566,638	V1332A	probably damaging	Het
Cftr	T	C	6: 18,299,833	S1172P	probably damaging	Het
Commd2	A	T	3: 57,646,814	D155E	probably benign	Het
Coq7	T	A	7: 118,528,267		probably benign	Het
Dnase2a	T	C	8: 84,909,578		probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Dock6	C	T	9: 21,841,603	V305I	probably benign	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Fasn	T	C	11: 120,808,882	Q2288R	probably benign	Het
Fat3	T	A	9: 15,960,313	N3594I	probably damaging	Het
Galnt10	T	C	11: 57,769,588	M284T	probably damaging	Het
Gatm	A	T	2: 122,595,503	F422L	probably benign	Het
Glrp1	A	T	1: 88,509,852	I12N	unknown	Het
Gm5455	T	A	13: 110,305,428		noncoding transcript	Het
Gm6768	A	C	12: 119,261,288		noncoding transcript	Het
Gm884	T	C	11: 103,543,121	Y898C	probably damaging	Het
Gpam	C	T	19: 55,083,227	E361K	probably damaging	Het
Gps2	A	G	11: 69,915,197	T126A	probably benign	Het
Grn	C	A	11: 102,430,554		probably benign	Het
Gsg1	T	A	6: 135,241,370	Q176L	probably damaging	Het
Htra1	C	T	7: 130,983,716	A412V	possibly damaging	Het
Icosl	C	T	10: 78,069,485		probably benign	Het
Iqgap1	T	C	7: 80,723,065	T1509A	probably damaging	Het
Itgad	T	C	7: 128,198,223		probably null	Het
Kdm5a	C	A	6: 120,430,016		probably benign	Het
Kidins220	T	C	12: 25,051,126	L1017S	probably benign	Het
Lrmp	A	G	6: 145,138,220	E37G	probably benign	Het
Man2b1	T	A	8: 85,095,784	S804R	probably damaging	Het
Miip	A	T	4: 147,863,069	F211L	probably damaging	Het
Moxd1	T	G	10: 24,279,547		probably null	Het
Moxd1	T	G	10: 24,287,136	Y499D	probably damaging	Het
Mrpl45	T	C	11: 97,316,751	I24T	probably benign	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Mthfr	T	A	4: 148,051,360		probably null	Het
Muc5b	T	A	7: 141,850,810	D827E	unknown	Het
Myo1g	G	C	11: 6,508,243	L866V	probably damaging	Het
Myo3a	A	T	2: 22,578,158	M475L	probably benign	Het
Ncoa2	A	C	1: 13,174,366	L703V	probably damaging	Het
Nme6	T	A	9: 109,841,489	Y69*	probably null	Het
Nwd1	T	A	8: 72,671,086	M651K	probably benign	Het
Olfr726	A	C	14: 50,084,546	I45S	probably damaging	Het
Orc2	A	T	1: 58,474,818	S298R	possibly damaging	Het
Oscp1	A	T	4: 126,087,729	E328V	probably damaging	Het
Pan2	T	C	10: 128,317,969	V1003A	probably damaging	Het
Pik3r4	T	C	9: 105,682,308	V1200A	possibly damaging	Het
Prl	T	C	13: 27,057,596		probably benign	Het
Ptprk	T	C	10: 28,475,236	V575A	probably benign	Het
Rflna	A	T	5: 125,011,405	S139C	probably damaging	Het
Robo1	T	C	16: 72,742,150	F27S	probably benign	Het
Secisbp2	T	C	13: 51,665,424	S347P	probably benign	Het
Shmt1	A	G	11: 60,797,482		probably benign	Het
Slc27a3	A	G	3: 90,389,170		probably null	Het
Slc6a5	T	C	7: 49,936,209	V425A	probably damaging	Het
Slc8a3	A	G	12: 81,314,491	V518A	possibly damaging	Het
Slco1a4	A	T	6: 141,839,631	Y78N	probably damaging	Het
Stt3b	A	T	9: 115,266,143	H273Q	probably damaging	Het
Tle6	T	A	10: 81,592,801	N431I	probably damaging	Het
Trim34b	C	A	7: 104,329,911	Q122K	possibly damaging	Het
Trio	C	A	15: 27,902,600	R258S	probably benign	Het
Ttc7	A	T	17: 87,292,878	D23V	probably damaging	Het
Ttn	A	T	2: 76,980,181	M1K	probably null	Het
Ufsp2	T	C	8: 45,994,089	V391A	probably benign	Het
Vps13c	T	C	9: 67,908,052	L990S	probably damaging	Het
Zfp108	G	T	7: 24,260,738	K251N	probably benign	Het
Zfp618	G	A	4: 63,099,282	M234I	probably benign	Het

Other mutations in Celsr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Celsr3	APN	9	108848925	missense	probably damaging	1.00
IGL00536:Celsr3	APN	9	108829192	missense	probably benign	0.33
IGL00552:Celsr3	APN	9	108841263	missense	possibly damaging	0.88
IGL00801:Celsr3	APN	9	108842576	missense	probably benign
IGL01420:Celsr3	APN	9	108841190	critical splice acceptor site	probably null
IGL01541:Celsr3	APN	9	108831708	missense	probably damaging	1.00
IGL01619:Celsr3	APN	9	108834557	missense	probably damaging	1.00
IGL01619:Celsr3	APN	9	108837404	missense	probably benign	0.00
IGL01631:Celsr3	APN	9	108837404	missense	probably benign	0.00
IGL01777:Celsr3	APN	9	108835942	missense	probably benign	0.08
IGL01938:Celsr3	APN	9	108828415	missense	probably benign	0.34
IGL02135:Celsr3	APN	9	108827556	missense	probably benign	0.11
IGL02231:Celsr3	APN	9	108842510	missense	probably damaging	1.00
IGL02234:Celsr3	APN	9	108829960	missense	probably benign
IGL02392:Celsr3	APN	9	108834721	splice site	probably benign
IGL02416:Celsr3	APN	9	108832119	missense	probably damaging	1.00
IGL02421:Celsr3	APN	9	108840463	missense	probably damaging	1.00
IGL02455:Celsr3	APN	9	108842893	missense	probably benign	0.15
IGL02798:Celsr3	APN	9	108843575	missense	probably damaging	1.00
IGL02939:Celsr3	APN	9	108849453	missense	probably damaging	1.00
IGL02947:Celsr3	APN	9	108845935	missense	probably benign	0.12
IGL02986:Celsr3	APN	9	108841255	splice site	probably null
IGL03089:Celsr3	APN	9	108826607	missense	probably benign	0.04
IGL03162:Celsr3	APN	9	108842558	missense	probably damaging	1.00
IGL03267:Celsr3	APN	9	108836525	splice site	probably benign
Diminishment	UTSW	9	108842708	intron	probably benign
little_d	UTSW	9	108827692	missense	probably damaging	0.98
nogal	UTSW	9	108835838	missense	probably benign
F6893:Celsr3	UTSW	9	108835067	missense	probably benign	0.00
PIT4243001:Celsr3	UTSW	9	108832308	missense	probably benign	0.13
PIT4810001:Celsr3	UTSW	9	108845733	missense	probably damaging	1.00
R0110:Celsr3	UTSW	9	108827005	missense	possibly damaging	0.62
R0243:Celsr3	UTSW	9	108843724	splice site	probably benign
R0382:Celsr3	UTSW	9	108829218	missense	probably damaging	1.00
R0482:Celsr3	UTSW	9	108829073	nonsense	probably null
R0510:Celsr3	UTSW	9	108827005	missense	possibly damaging	0.62
R0630:Celsr3	UTSW	9	108827692	missense	probably damaging	0.98
R0656:Celsr3	UTSW	9	108834655	missense	possibly damaging	0.89
R0764:Celsr3	UTSW	9	108827818	missense	probably damaging	1.00
R0883:Celsr3	UTSW	9	108842633	missense	probably damaging	1.00
R0924:Celsr3	UTSW	9	108846025	missense	possibly damaging	0.78
R1015:Celsr3	UTSW	9	108833176	missense	probably benign	0.17
R1321:Celsr3	UTSW	9	108835870	missense	probably damaging	1.00
R1423:Celsr3	UTSW	9	108826905	missense	probably benign	0.00
R1497:Celsr3	UTSW	9	108848865	missense	probably benign	0.14
R1520:Celsr3	UTSW	9	108848658	missense	probably damaging	1.00
R1534:Celsr3	UTSW	9	108848884	missense	probably damaging	0.99
R1569:Celsr3	UTSW	9	108829068	missense	probably damaging	1.00
R1657:Celsr3	UTSW	9	108842952	nonsense	probably null
R1753:Celsr3	UTSW	9	108831857	missense	probably damaging	0.99
R1764:Celsr3	UTSW	9	108828958	missense	probably damaging	1.00
R1801:Celsr3	UTSW	9	108834626	missense	possibly damaging	0.88
R1838:Celsr3	UTSW	9	108829906	missense	probably benign
R1839:Celsr3	UTSW	9	108829906	missense	probably benign
R1874:Celsr3	UTSW	9	108835838	missense	probably benign
R1875:Celsr3	UTSW	9	108835838	missense	probably benign
R1953:Celsr3	UTSW	9	108843182	missense	probably benign	0.19
R1960:Celsr3	UTSW	9	108845817	missense	probably benign
R2113:Celsr3	UTSW	9	108838470	missense	probably damaging	1.00
R2290:Celsr3	UTSW	9	108843224	missense	probably damaging	1.00
R2369:Celsr3	UTSW	9	108842552	missense	probably benign
R2373:Celsr3	UTSW	9	108842552	missense	probably benign
R2374:Celsr3	UTSW	9	108842552	missense	probably benign
R2375:Celsr3	UTSW	9	108842552	missense	probably benign
R2844:Celsr3	UTSW	9	108829308	missense	probably damaging	1.00
R2968:Celsr3	UTSW	9	108832191	missense	probably damaging	1.00
R3103:Celsr3	UTSW	9	108837139	missense	probably benign	0.31
R3159:Celsr3	UTSW	9	108827710	missense	possibly damaging	0.94
R3791:Celsr3	UTSW	9	108842552	missense	probably benign
R4194:Celsr3	UTSW	9	108843302	critical splice donor site	probably null
R4329:Celsr3	UTSW	9	108846049	missense	probably benign	0.00
R4365:Celsr3	UTSW	9	108829847	missense	possibly damaging	0.47
R4419:Celsr3	UTSW	9	108843244	missense	possibly damaging	0.84
R4484:Celsr3	UTSW	9	108846063	critical splice donor site	probably null
R4582:Celsr3	UTSW	9	108845723	missense	probably damaging	1.00
R4681:Celsr3	UTSW	9	108827754	missense	possibly damaging	0.58
R4729:Celsr3	UTSW	9	108847652	missense	probably benign	0.05
R4881:Celsr3	UTSW	9	108843941	missense	probably damaging	1.00
R4893:Celsr3	UTSW	9	108849421	missense	probably damaging	1.00
R5207:Celsr3	UTSW	9	108832759	missense	probably benign	0.01
R5290:Celsr3	UTSW	9	108843158	missense	probably benign	0.01
R5327:Celsr3	UTSW	9	108842708	intron	probably benign
R5345:Celsr3	UTSW	9	108832124	missense	probably damaging	1.00
R5358:Celsr3	UTSW	9	108832025	missense	possibly damaging	0.96
R5396:Celsr3	UTSW	9	108828582	missense	probably damaging	1.00
R5414:Celsr3	UTSW	9	108840042	missense	possibly damaging	0.88
R5452:Celsr3	UTSW	9	108844034	missense	possibly damaging	0.68
R5467:Celsr3	UTSW	9	108828637	missense	probably damaging	1.00
R5479:Celsr3	UTSW	9	108844544	critical splice donor site	probably null
R5629:Celsr3	UTSW	9	108849067	missense	probably benign	0.41
R5637:Celsr3	UTSW	9	108837133	missense	probably damaging	1.00
R5652:Celsr3	UTSW	9	108838472	missense	probably benign	0.03
R5739:Celsr3	UTSW	9	108827158	missense	probably benign
R5785:Celsr3	UTSW	9	108827797	missense	probably damaging	1.00
R5877:Celsr3	UTSW	9	108845727	missense	probably damaging	0.98
R5961:Celsr3	UTSW	9	108831794	missense	probably damaging	1.00
R6046:Celsr3	UTSW	9	108837151	missense	probably benign	0.01
R6176:Celsr3	UTSW	9	108828355	missense	probably damaging	1.00
R6291:Celsr3	UTSW	9	108828842	missense	probably damaging	1.00
R6468:Celsr3	UTSW	9	108835790	missense	probably benign	0.08
R6481:Celsr3	UTSW	9	108837084	missense	possibly damaging	0.92
R6547:Celsr3	UTSW	9	108829128	missense	probably damaging	1.00
R6763:Celsr3	UTSW	9	108827350	missense	probably damaging	1.00
R6870:Celsr3	UTSW	9	108829191	missense	probably benign	0.02
R6977:Celsr3	UTSW	9	108827715	missense	probably benign
R7061:Celsr3	UTSW	9	108847594	nonsense	probably null
R7122:Celsr3	UTSW	9	108828567	missense	possibly damaging	0.90
R7156:Celsr3	UTSW	9	108838004	missense	possibly damaging	0.95
R7166:Celsr3	UTSW	9	108842951	missense	probably damaging	1.00
R7176:Celsr3	UTSW	9	108845762	missense	probably benign
R7213:Celsr3	UTSW	9	108849040	missense	probably damaging	0.98
R7314:Celsr3	UTSW	9	108829144	missense	probably damaging	1.00
R7478:Celsr3	UTSW	9	108843578	missense	probably benign	0.37
R7508:Celsr3	UTSW	9	108836622	missense	probably benign
R7554:Celsr3	UTSW	9	108841209	missense	probably benign
R7615:Celsr3	UTSW	9	108837652	missense	possibly damaging	0.75
R7653:Celsr3	UTSW	9	108835070	nonsense	probably null
R7747:Celsr3	UTSW	9	108829978	missense	possibly damaging	0.61
R7881:Celsr3	UTSW	9	108828072	missense	probably benign	0.28
R7935:Celsr3	UTSW	9	108829641	missense	probably benign	0.01
R7995:Celsr3	UTSW	9	108845083	missense	probably damaging	0.99
R8006:Celsr3	UTSW	9	108829107	missense	probably damaging	1.00
R8077:Celsr3	UTSW	9	108828331	missense	probably benign	0.15
R8284:Celsr3	UTSW	9	108846413	missense	probably damaging	0.99
R8291:Celsr3	UTSW	9	108837970	missense	probably damaging	1.00
R8322:Celsr3	UTSW	9	108848794	missense	probably damaging	1.00
R8334:Celsr3	UTSW	9	108841272	frame shift	probably null
R8337:Celsr3	UTSW	9	108841272	frame shift	probably null
R8338:Celsr3	UTSW	9	108827340	nonsense	probably null
R8353:Celsr3	UTSW	9	108826535	missense	probably benign	0.00
R8407:Celsr3	UTSW	9	108829057	missense	probably damaging	1.00
R8408:Celsr3	UTSW	9	108831789	missense	probably damaging	1.00
R8459:Celsr3	UTSW	9	108829630	missense	probably damaging	1.00
R8510:Celsr3	UTSW	9	108838120	missense	possibly damaging	0.93
R8713:Celsr3	UTSW	9	108829863	missense	probably benign
R8728:Celsr3	UTSW	9	108846741	missense	probably benign	0.24
R8829:Celsr3	UTSW	9	108840383	missense	probably benign
R8877:Celsr3	UTSW	9	108829678	missense	probably damaging	1.00
R8905:Celsr3	UTSW	9	108841302	missense	probably damaging	1.00
R9008:Celsr3	UTSW	9	108828952	missense	possibly damaging	0.94
R9072:Celsr3	UTSW	9	108827094	missense	probably benign
R9157:Celsr3	UTSW	9	108829986	missense	probably damaging	1.00
R9183:Celsr3	UTSW	9	108829396	missense	probably damaging	1.00
R9275:Celsr3	UTSW	9	108838490	missense	probably benign	0.27
R9361:Celsr3	UTSW	9	108849322	missense	probably damaging	1.00
R9382:Celsr3	UTSW	9	108829762	missense	possibly damaging	0.60
R9407:Celsr3	UTSW	9	108846397	missense	probably damaging	1.00
R9432:Celsr3	UTSW	9	108848833	missense	probably benign	0.00
R9607:Celsr3	UTSW	9	108840502	critical splice donor site	probably null
R9626:Celsr3	UTSW	9	108849322	missense	probably damaging	1.00
R9628:Celsr3	UTSW	9	108826360	nonsense	probably null
R9630:Celsr3	UTSW	9	108827097	missense	probably benign
R9645:Celsr3	UTSW	9	108827492	nonsense	probably null
R9683:Celsr3	UTSW	9	108827323	missense	probably damaging	1.00
R9794:Celsr3	UTSW	9	108851303	missense	probably benign	0.00
R9798:Celsr3	UTSW	9	108828595	missense	probably damaging	1.00
RF020:Celsr3	UTSW	9	108849057	missense	probably benign
X0018:Celsr3	UTSW	9	108827778	missense	possibly damaging	0.65
X0018:Celsr3	UTSW	9	108840412	missense	probably benign	0.01
X0026:Celsr3	UTSW	9	108828930	missense	probably damaging	0.99
Z1177:Celsr3	UTSW	9	108826477	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- AAAACCAGGGATCATGCCGG -3'
(R):5'- CAGATTAAGAGGTTAGGGCCC -3'

Sequencing Primer
(F):5'- TCATGCCGGCACCTCCAAG -3'
(R):5'- TTAGGGCCCAAGTCAGGTG -3'

Posted On

2016-07-06