Mutagenetix > Incidental Mutations

Incidental Mutation 'R5183:Slc8a3'

397702

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

042762-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5183 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81314491 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 518 (V518A)

Ref Sequence

ENSEMBL: ENSMUSP00000063258 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064594
AA Change: V518A

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: V518A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000085238
AA Change: V518A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: V518A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182208
AA Change: V518A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: V518A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183102

Meta Mutation Damage Score

0.1208

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,739,305	D8E	probably damaging	Het
Abca3	T	G	17: 24,374,453	S275A	probably benign	Het
Adk	A	G	14: 21,240,531	N155S	probably damaging	Het
Aqp11	T	C	7: 97,737,756	T78A	probably benign	Het
Arhgef40	T	C	14: 52,004,099	V1455A	probably damaging	Het
Asxl3	C	G	18: 22,525,299	A2122G	possibly damaging	Het
Cdan1	T	A	2: 120,729,580	I368F	probably damaging	Het
Cdc42bpg	A	G	19: 6,321,805		probably benign	Het
Celsr3	A	G	9: 108,837,560	D2013G	probably damaging	Het
Cep152	A	G	2: 125,566,638	V1332A	probably damaging	Het
Cftr	T	C	6: 18,299,833	S1172P	probably damaging	Het
Commd2	A	T	3: 57,646,814	D155E	probably benign	Het
Coq7	T	A	7: 118,528,267		probably benign	Het
Dnase2a	T	C	8: 84,909,578		probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Dock6	C	T	9: 21,841,603	V305I	probably benign	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Fasn	T	C	11: 120,808,882	Q2288R	probably benign	Het
Fat3	T	A	9: 15,960,313	N3594I	probably damaging	Het
Galnt10	T	C	11: 57,769,588	M284T	probably damaging	Het
Gatm	A	T	2: 122,595,503	F422L	probably benign	Het
Glrp1	A	T	1: 88,509,852	I12N	unknown	Het
Gm5455	T	A	13: 110,305,428		noncoding transcript	Het
Gm6768	A	C	12: 119,261,288		noncoding transcript	Het
Gm884	T	C	11: 103,543,121	Y898C	probably damaging	Het
Gpam	C	T	19: 55,083,227	E361K	probably damaging	Het
Gps2	A	G	11: 69,915,197	T126A	probably benign	Het
Grn	C	A	11: 102,430,554		probably benign	Het
Gsg1	T	A	6: 135,241,370	Q176L	probably damaging	Het
Htra1	C	T	7: 130,983,716	A412V	possibly damaging	Het
Icosl	C	T	10: 78,069,485		probably benign	Het
Iqgap1	T	C	7: 80,723,065	T1509A	probably damaging	Het
Itgad	T	C	7: 128,198,223		probably null	Het
Kdm5a	C	A	6: 120,430,016		probably benign	Het
Kidins220	T	C	12: 25,051,126	L1017S	probably benign	Het
Lrmp	A	G	6: 145,138,220	E37G	probably benign	Het
Man2b1	T	A	8: 85,095,784	S804R	probably damaging	Het
Miip	A	T	4: 147,863,069	F211L	probably damaging	Het
Moxd1	T	G	10: 24,287,136	Y499D	probably damaging	Het
Moxd1	T	G	10: 24,279,547		probably null	Het
Mrpl45	T	C	11: 97,316,751	I24T	probably benign	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Mthfr	T	A	4: 148,051,360		probably null	Het
Muc5b	T	A	7: 141,850,810	D827E	unknown	Het
Myo1g	G	C	11: 6,508,243	L866V	probably damaging	Het
Myo3a	A	T	2: 22,578,158	M475L	probably benign	Het
Ncoa2	A	C	1: 13,174,366	L703V	probably damaging	Het
Nme6	T	A	9: 109,841,489	Y69*	probably null	Het
Nwd1	T	A	8: 72,671,086	M651K	probably benign	Het
Olfr726	A	C	14: 50,084,546	I45S	probably damaging	Het
Orc2	A	T	1: 58,474,818	S298R	possibly damaging	Het
Oscp1	A	T	4: 126,087,729	E328V	probably damaging	Het
Pan2	T	C	10: 128,317,969	V1003A	probably damaging	Het
Pik3r4	T	C	9: 105,682,308	V1200A	possibly damaging	Het
Prl	T	C	13: 27,057,596		probably benign	Het
Ptprk	T	C	10: 28,475,236	V575A	probably benign	Het
Rflna	A	T	5: 125,011,405	S139C	probably damaging	Het
Robo1	T	C	16: 72,742,150	F27S	probably benign	Het
Secisbp2	T	C	13: 51,665,424	S347P	probably benign	Het
Shmt1	A	G	11: 60,797,482		probably benign	Het
Slc27a3	A	G	3: 90,389,170		probably null	Het
Slc6a5	T	C	7: 49,936,209	V425A	probably damaging	Het
Slco1a4	A	T	6: 141,839,631	Y78N	probably damaging	Het
Stt3b	A	T	9: 115,266,143	H273Q	probably damaging	Het
Tle6	T	A	10: 81,592,801	N431I	probably damaging	Het
Trim34b	C	A	7: 104,329,911	Q122K	possibly damaging	Het
Trio	C	A	15: 27,902,600	R258S	probably benign	Het
Ttc7	A	T	17: 87,292,878	D23V	probably damaging	Het
Ttn	A	T	2: 76,980,181	M1K	probably null	Het
Ufsp2	T	C	8: 45,994,089	V391A	probably benign	Het
Vps13c	T	C	9: 67,908,052	L990S	probably damaging	Het
Zfp108	G	T	7: 24,260,738	K251N	probably benign	Het
Zfp618	G	A	4: 63,099,282	M234I	probably benign	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- ATGCATCTTCAAAGTCCTCGC -3'
(R):5'- AGGGCACTGTGGTTCTGAAG -3'

Sequencing Primer
(F):5'- TCTTCAAAGTCCTCGCCACCAC -3'
(R):5'- CACTGTGGTTCTGAAGCCAGG -3'

Posted On

2016-07-06