Incidental Mutation 'R5183:Arhgef40'
ID 397709
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene Name Rho guanine nucleotide exchange factor 40
Synonyms E130112L23Rik
MMRRC Submission 042762-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R5183 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 52222176-52243708 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52241556 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1455 (V1455A)
Ref Sequence ENSEMBL: ENSMUSP00000138635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067549] [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000166169] [ENSMUST00000182061] [ENSMUST00000182760] [ENSMUST00000182909] [ENSMUST00000182905] [ENSMUST00000183208] [ENSMUST00000226964] [ENSMUST00000228580] [ENSMUST00000226522]
AlphaFold Q3UPH7
Predicted Effect probably benign
Transcript: ENSMUST00000067549
SMART Domains Protein: ENSMUSP00000068184
Gene: ENSMUSG00000049295

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
ZnF_C2H2 61 83 6.23e-2 SMART
ZnF_C2H2 89 111 4.17e-3 SMART
low complexity region 113 146 N/A INTRINSIC
ZnF_C2H2 167 190 3.07e-1 SMART
ZnF_C2H2 193 216 1.51e0 SMART
low complexity region 229 276 N/A INTRINSIC
ZnF_C2H2 277 299 8.47e-4 SMART
ZnF_C2H2 305 327 1.38e-3 SMART
low complexity region 331 350 N/A INTRINSIC
low complexity region 354 379 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
ZnF_C2H2 501 523 3.63e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
low complexity region 560 570 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
ZnF_C2H2 650 672 2.82e0 SMART
low complexity region 675 684 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093813
AA Change: V1455A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562
AA Change: V1455A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100639
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166169
SMART Domains Protein: ENSMUSP00000126854
Gene: ENSMUSG00000049295

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
ZnF_C2H2 61 83 6.23e-2 SMART
ZnF_C2H2 89 111 4.17e-3 SMART
low complexity region 113 146 N/A INTRINSIC
ZnF_C2H2 167 190 3.07e-1 SMART
ZnF_C2H2 193 216 1.51e0 SMART
low complexity region 229 276 N/A INTRINSIC
ZnF_C2H2 277 299 8.47e-4 SMART
ZnF_C2H2 305 327 1.38e-3 SMART
low complexity region 331 350 N/A INTRINSIC
low complexity region 354 379 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
ZnF_C2H2 501 523 3.63e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
low complexity region 560 570 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
ZnF_C2H2 650 672 2.82e0 SMART
low complexity region 675 684 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182061
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182217
AA Change: V52A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182644
Predicted Effect unknown
Transcript: ENSMUST00000182667
AA Change: V112A
Predicted Effect unknown
Transcript: ENSMUST00000182828
AA Change: V6A
Predicted Effect possibly damaging
Transcript: ENSMUST00000182760
AA Change: V1464A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562
AA Change: V1464A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182909
AA Change: V1455A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562
AA Change: V1455A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182777
Predicted Effect probably benign
Transcript: ENSMUST00000182905
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183208
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226964
Predicted Effect probably benign
Transcript: ENSMUST00000228580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226474
Predicted Effect probably benign
Transcript: ENSMUST00000226522
Meta Mutation Damage Score 0.0890 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,887,171 (GRCm39) D8E probably damaging Het
Abca3 T G 17: 24,593,427 (GRCm39) S275A probably benign Het
Adk A G 14: 21,290,599 (GRCm39) N155S probably damaging Het
Aqp11 T C 7: 97,386,963 (GRCm39) T78A probably benign Het
Asxl3 C G 18: 22,658,356 (GRCm39) A2122G possibly damaging Het
Cdan1 T A 2: 120,560,061 (GRCm39) I368F probably damaging Het
Cdc42bpg A G 19: 6,371,835 (GRCm39) probably benign Het
Celsr3 A G 9: 108,714,759 (GRCm39) D2013G probably damaging Het
Cep152 A G 2: 125,408,558 (GRCm39) V1332A probably damaging Het
Cftr T C 6: 18,299,832 (GRCm39) S1172P probably damaging Het
Commd2 A T 3: 57,554,235 (GRCm39) D155E probably benign Het
Coq7 T A 7: 118,127,490 (GRCm39) probably benign Het
Dnase2a T C 8: 85,636,207 (GRCm39) probably benign Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Dock6 C T 9: 21,752,899 (GRCm39) V305I probably benign Het
Ehmt1 G T 2: 24,767,509 (GRCm39) P135T probably damaging Het
Fasn T C 11: 120,699,708 (GRCm39) Q2288R probably benign Het
Fat3 T A 9: 15,871,609 (GRCm39) N3594I probably damaging Het
Galnt10 T C 11: 57,660,414 (GRCm39) M284T probably damaging Het
Gatm A T 2: 122,425,984 (GRCm39) F422L probably benign Het
Glrp1 A T 1: 88,437,574 (GRCm39) I12N unknown Het
Gm5455 T A 13: 110,441,962 (GRCm39) noncoding transcript Het
Gpam C T 19: 55,071,659 (GRCm39) E361K probably damaging Het
Gps2 A G 11: 69,806,023 (GRCm39) T126A probably benign Het
Grn C A 11: 102,321,380 (GRCm39) probably benign Het
Gsg1 T A 6: 135,218,368 (GRCm39) Q176L probably damaging Het
Htra1 C T 7: 130,585,446 (GRCm39) A412V possibly damaging Het
Icosl C T 10: 77,905,319 (GRCm39) probably benign Het
Iqgap1 T C 7: 80,372,813 (GRCm39) T1509A probably damaging Het
Irag2 A G 6: 145,083,946 (GRCm39) E37G probably benign Het
Itgad T C 7: 127,797,395 (GRCm39) probably null Het
Kdm5a C A 6: 120,406,977 (GRCm39) probably benign Het
Kidins220 T C 12: 25,101,125 (GRCm39) L1017S probably benign Het
Lrrc37 T C 11: 103,433,947 (GRCm39) Y898C probably damaging Het
Man2b1 T A 8: 85,822,413 (GRCm39) S804R probably damaging Het
Miip A T 4: 147,947,526 (GRCm39) F211L probably damaging Het
Moxd1 T G 10: 24,155,445 (GRCm39) probably null Het
Moxd1 T G 10: 24,163,034 (GRCm39) Y499D probably damaging Het
Mrpl45 T C 11: 97,207,577 (GRCm39) I24T probably benign Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Mthfr T A 4: 148,135,817 (GRCm39) probably null Het
Muc5b T A 7: 141,404,547 (GRCm39) D827E unknown Het
Myo1g G C 11: 6,458,243 (GRCm39) L866V probably damaging Het
Myo3a A T 2: 22,468,170 (GRCm39) M475L probably benign Het
Ncoa2 A C 1: 13,244,590 (GRCm39) L703V probably damaging Het
Ncoa4-ps A C 12: 119,225,023 (GRCm39) noncoding transcript Het
Nme6 T A 9: 109,670,557 (GRCm39) Y69* probably null Het
Nwd1 T A 8: 73,397,714 (GRCm39) M651K probably benign Het
Or4k15c A C 14: 50,322,003 (GRCm39) I45S probably damaging Het
Orc2 A T 1: 58,513,977 (GRCm39) S298R possibly damaging Het
Oscp1 A T 4: 125,981,522 (GRCm39) E328V probably damaging Het
Pan2 T C 10: 128,153,838 (GRCm39) V1003A probably damaging Het
Pik3r4 T C 9: 105,559,507 (GRCm39) V1200A possibly damaging Het
Prl T C 13: 27,241,579 (GRCm39) probably benign Het
Ptprk T C 10: 28,351,232 (GRCm39) V575A probably benign Het
Rflna A T 5: 125,088,469 (GRCm39) S139C probably damaging Het
Robo1 T C 16: 72,539,038 (GRCm39) F27S probably benign Het
Secisbp2 T C 13: 51,819,460 (GRCm39) S347P probably benign Het
Shmt1 A G 11: 60,688,308 (GRCm39) probably benign Het
Slc27a3 A G 3: 90,296,477 (GRCm39) probably null Het
Slc6a5 T C 7: 49,585,957 (GRCm39) V425A probably damaging Het
Slc8a3 A G 12: 81,361,265 (GRCm39) V518A possibly damaging Het
Slco1a4 A T 6: 141,785,357 (GRCm39) Y78N probably damaging Het
Stt3b A T 9: 115,095,211 (GRCm39) H273Q probably damaging Het
Tle6 T A 10: 81,428,635 (GRCm39) N431I probably damaging Het
Trim34b C A 7: 103,979,118 (GRCm39) Q122K possibly damaging Het
Trio C A 15: 27,902,686 (GRCm39) R258S probably benign Het
Ttc7 A T 17: 87,600,306 (GRCm39) D23V probably damaging Het
Ttn A T 2: 76,810,525 (GRCm39) M1K probably null Het
Ufsp2 T C 8: 46,447,126 (GRCm39) V391A probably benign Het
Vps13c T C 9: 67,815,334 (GRCm39) L990S probably damaging Het
Zfp108 G T 7: 23,960,163 (GRCm39) K251N probably benign Het
Zfp618 G A 4: 63,017,519 (GRCm39) M234I probably benign Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 52,226,417 (GRCm39) missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 52,224,884 (GRCm39) missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 52,229,155 (GRCm39) critical splice donor site probably null
IGL01123:Arhgef40 APN 14 52,231,803 (GRCm39) missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 52,226,862 (GRCm39) missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 52,226,652 (GRCm39) missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52,238,320 (GRCm39) missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 52,234,865 (GRCm39) missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 52,234,431 (GRCm39) missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52,242,364 (GRCm39) unclassified probably benign
R0608:Arhgef40 UTSW 14 52,234,431 (GRCm39) missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52,238,450 (GRCm39) missense probably benign 0.05
R1126:Arhgef40 UTSW 14 52,234,583 (GRCm39) missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 52,227,613 (GRCm39) missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52,241,538 (GRCm39) missense probably damaging 1.00
R1794:Arhgef40 UTSW 14 52,227,387 (GRCm39) missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 52,235,080 (GRCm39) missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52,241,162 (GRCm39) missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 52,233,640 (GRCm39) missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 52,231,733 (GRCm39) splice site probably benign
R3877:Arhgef40 UTSW 14 52,239,742 (GRCm39) missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 52,227,628 (GRCm39) missense possibly damaging 0.50
R4596:Arhgef40 UTSW 14 52,224,681 (GRCm39) critical splice donor site probably null
R4676:Arhgef40 UTSW 14 52,228,416 (GRCm39) nonsense probably null
R4703:Arhgef40 UTSW 14 52,239,767 (GRCm39) missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52,239,767 (GRCm39) missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52,242,395 (GRCm39) unclassified probably benign
R4915:Arhgef40 UTSW 14 52,227,556 (GRCm39) missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 52,227,556 (GRCm39) missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 52,227,556 (GRCm39) missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 52,227,146 (GRCm39) missense probably damaging 1.00
R5195:Arhgef40 UTSW 14 52,227,269 (GRCm39) missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 52,227,156 (GRCm39) missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 52,229,306 (GRCm39) missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 52,233,614 (GRCm39) missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 52,231,795 (GRCm39) missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52,238,357 (GRCm39) missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 52,234,489 (GRCm39) missense probably damaging 1.00
R5820:Arhgef40 UTSW 14 52,224,953 (GRCm39) missense possibly damaging 0.76
R6229:Arhgef40 UTSW 14 52,227,547 (GRCm39) missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52,238,456 (GRCm39) missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 52,234,888 (GRCm39) missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 52,228,419 (GRCm39) unclassified probably benign
R6675:Arhgef40 UTSW 14 52,229,098 (GRCm39) missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 52,235,354 (GRCm39) intron probably benign
R6901:Arhgef40 UTSW 14 52,234,825 (GRCm39) missense probably damaging 1.00
R7852:Arhgef40 UTSW 14 52,229,254 (GRCm39) missense unknown
R7857:Arhgef40 UTSW 14 52,226,212 (GRCm39) missense probably damaging 0.97
R7914:Arhgef40 UTSW 14 52,225,032 (GRCm39) missense probably damaging 1.00
R8060:Arhgef40 UTSW 14 52,222,452 (GRCm39) splice site probably benign
R8144:Arhgef40 UTSW 14 52,235,632 (GRCm39) missense probably damaging 1.00
R8195:Arhgef40 UTSW 14 52,226,226 (GRCm39) missense probably damaging 1.00
R8432:Arhgef40 UTSW 14 52,226,857 (GRCm39) missense probably benign 0.00
R8738:Arhgef40 UTSW 14 52,238,414 (GRCm39) missense probably damaging 1.00
R8830:Arhgef40 UTSW 14 52,241,165 (GRCm39) missense probably damaging 1.00
R9038:Arhgef40 UTSW 14 52,235,072 (GRCm39) missense probably damaging 0.96
R9712:Arhgef40 UTSW 14 52,226,415 (GRCm39) missense probably damaging 0.99
U24488:Arhgef40 UTSW 14 52,235,673 (GRCm39) missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52,241,141 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCCTCTGTGAGCTGTTC -3'
(R):5'- TGTAAGCATCTCCCTAGCAAC -3'

Sequencing Primer
(F):5'- CATGGAGCCAGGAGGACTTTTC -3'
(R):5'- CAACCAGATGGAAGGCTCTTTTAGC -3'
Posted On 2016-07-06