Mutagenetix > Incidental Mutations

Incidental Mutation 'R5183:Trio'

397710

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

042762-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5183 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 27902600 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 258 (R258S)

Ref Sequence

ENSEMBL: ENSMUSP00000154653 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226775] [ENSMUST00000227337]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000090247
AA Change: R317S

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: R317S

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226775

Predicted Effect

probably benign
Transcript: ENSMUST00000227337
AA Change: R258S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,739,305	D8E	probably damaging	Het
Abca3	T	G	17: 24,374,453	S275A	probably benign	Het
Adk	A	G	14: 21,240,531	N155S	probably damaging	Het
Aqp11	T	C	7: 97,737,756	T78A	probably benign	Het
Arhgef40	T	C	14: 52,004,099	V1455A	probably damaging	Het
Asxl3	C	G	18: 22,525,299	A2122G	possibly damaging	Het
Cdan1	T	A	2: 120,729,580	I368F	probably damaging	Het
Cdc42bpg	A	G	19: 6,321,805		probably benign	Het
Celsr3	A	G	9: 108,837,560	D2013G	probably damaging	Het
Cep152	A	G	2: 125,566,638	V1332A	probably damaging	Het
Cftr	T	C	6: 18,299,833	S1172P	probably damaging	Het
Commd2	A	T	3: 57,646,814	D155E	probably benign	Het
Coq7	T	A	7: 118,528,267		probably benign	Het
Dnase2a	T	C	8: 84,909,578		probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Dock6	C	T	9: 21,841,603	V305I	probably benign	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Fasn	T	C	11: 120,808,882	Q2288R	probably benign	Het
Fat3	T	A	9: 15,960,313	N3594I	probably damaging	Het
Galnt10	T	C	11: 57,769,588	M284T	probably damaging	Het
Gatm	A	T	2: 122,595,503	F422L	probably benign	Het
Glrp1	A	T	1: 88,509,852	I12N	unknown	Het
Gm5455	T	A	13: 110,305,428		noncoding transcript	Het
Gm6768	A	C	12: 119,261,288		noncoding transcript	Het
Gm884	T	C	11: 103,543,121	Y898C	probably damaging	Het
Gpam	C	T	19: 55,083,227	E361K	probably damaging	Het
Gps2	A	G	11: 69,915,197	T126A	probably benign	Het
Grn	C	A	11: 102,430,554		probably benign	Het
Gsg1	T	A	6: 135,241,370	Q176L	probably damaging	Het
Htra1	C	T	7: 130,983,716	A412V	possibly damaging	Het
Icosl	C	T	10: 78,069,485		probably benign	Het
Iqgap1	T	C	7: 80,723,065	T1509A	probably damaging	Het
Itgad	T	C	7: 128,198,223		probably null	Het
Kdm5a	C	A	6: 120,430,016		probably benign	Het
Kidins220	T	C	12: 25,051,126	L1017S	probably benign	Het
Lrmp	A	G	6: 145,138,220	E37G	probably benign	Het
Man2b1	T	A	8: 85,095,784	S804R	probably damaging	Het
Miip	A	T	4: 147,863,069	F211L	probably damaging	Het
Moxd1	T	G	10: 24,279,547		probably null	Het
Moxd1	T	G	10: 24,287,136	Y499D	probably damaging	Het
Mrpl45	T	C	11: 97,316,751	I24T	probably benign	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Mthfr	T	A	4: 148,051,360		probably null	Het
Muc5b	T	A	7: 141,850,810	D827E	unknown	Het
Myo1g	G	C	11: 6,508,243	L866V	probably damaging	Het
Myo3a	A	T	2: 22,578,158	M475L	probably benign	Het
Ncoa2	A	C	1: 13,174,366	L703V	probably damaging	Het
Nme6	T	A	9: 109,841,489	Y69*	probably null	Het
Nwd1	T	A	8: 72,671,086	M651K	probably benign	Het
Olfr726	A	C	14: 50,084,546	I45S	probably damaging	Het
Orc2	A	T	1: 58,474,818	S298R	possibly damaging	Het
Oscp1	A	T	4: 126,087,729	E328V	probably damaging	Het
Pan2	T	C	10: 128,317,969	V1003A	probably damaging	Het
Pik3r4	T	C	9: 105,682,308	V1200A	possibly damaging	Het
Prl	T	C	13: 27,057,596		probably benign	Het
Ptprk	T	C	10: 28,475,236	V575A	probably benign	Het
Rflna	A	T	5: 125,011,405	S139C	probably damaging	Het
Robo1	T	C	16: 72,742,150	F27S	probably benign	Het
Secisbp2	T	C	13: 51,665,424	S347P	probably benign	Het
Shmt1	A	G	11: 60,797,482		probably benign	Het
Slc27a3	A	G	3: 90,389,170		probably null	Het
Slc6a5	T	C	7: 49,936,209	V425A	probably damaging	Het
Slc8a3	A	G	12: 81,314,491	V518A	possibly damaging	Het
Slco1a4	A	T	6: 141,839,631	Y78N	probably damaging	Het
Stt3b	A	T	9: 115,266,143	H273Q	probably damaging	Het
Tle6	T	A	10: 81,592,801	N431I	probably damaging	Het
Trim34b	C	A	7: 104,329,911	Q122K	possibly damaging	Het
Ttc7	A	T	17: 87,292,878	D23V	probably damaging	Het
Ttn	A	T	2: 76,980,181	M1K	probably null	Het
Ufsp2	T	C	8: 45,994,089	V391A	probably benign	Het
Vps13c	T	C	9: 67,908,052	L990S	probably damaging	Het
Zfp108	G	T	7: 24,260,738	K251N	probably benign	Het
Zfp618	G	A	4: 63,099,282	M234I	probably benign	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0564:Trio	UTSW	15	27805822	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27758347	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27744146	splice site	probably null
R1780:Trio	UTSW	15	27744038	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27823975	splice site	probably null
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27749797	nonsense	probably null
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27772998	small deletion	probably benign
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5186:Trio	UTSW	15	27897991	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5344:Trio	UTSW	15	27735532	missense	probably benign	0.12
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27891459	missense	probably benign	0.10
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27743952	critical splice donor site	probably null
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27832051	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
R7833:Trio	UTSW	15	27774086	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27805684	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27851924	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27772935	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27749866	missense	probably benign	0.35
R8050:Trio	UTSW	15	27891454	missense	unknown
R8217:Trio	UTSW	15	27818969	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27902910	missense	unknown
R8283:Trio	UTSW	15	27756542	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27855022	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27881326	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27773952	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27901200	missense	probably benign	0.25
R8682:Trio	UTSW	15	27905192	missense	unknown
R8688:Trio	UTSW	15	27748238	missense	possibly damaging	0.61
R8708:Trio	UTSW	15	27732546	missense	probably damaging	0.99
R8709:Trio	UTSW	15	27919237	missense	unknown
R8713:Trio	UTSW	15	27743951	critical splice donor site	probably benign
R8798:Trio	UTSW	15	27851837	missense	possibly damaging	0.92
R8812:Trio	UTSW	15	27905225	missense	unknown
R8816:Trio	UTSW	15	27741271	missense	probably damaging	0.96
R8828:Trio	UTSW	15	27741064	missense	possibly damaging	0.93
R8987:Trio	UTSW	15	27732687	missense	probably benign	0.23
R9051:Trio	UTSW	15	27732684	missense	possibly damaging	0.78
R9069:Trio	UTSW	15	27852011	missense	possibly damaging	0.83
R9075:Trio	UTSW	15	27773936	nonsense	probably null
R9079:Trio	UTSW	15	27732937	missense	possibly damaging	0.52
R9139:Trio	UTSW	15	27749836	nonsense	probably null
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27771387	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCATGAGTCTTGGCTGTGAGAC -3'
(R):5'- AGTTGCCTCAGGACCTAGAG -3'

Sequencing Primer
(F):5'- TTGGCTGTGAGACCCACTAAC -3'
(R):5'- CTCGGAACATGATCGACGAGC -3'

Posted On

2016-07-06