Incidental Mutation 'R5184:Kcnq5'
ID397718
Institutional Source Beutler Lab
Gene Symbol Kcnq5
Ensembl Gene ENSMUSG00000028033
Gene Namepotassium voltage-gated channel, subfamily Q, member 5
Synonyms9230107O05Rik, D1Mgi1
MMRRC Submission 042763-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R5184 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location21398403-21961942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21402487 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 826 (D826E)
Ref Sequence ENSEMBL: ENSMUSP00000029667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029667] [ENSMUST00000115300] [ENSMUST00000173058] [ENSMUST00000173404] [ENSMUST00000174183]
Predicted Effect probably damaging
Transcript: ENSMUST00000029667
AA Change: D826E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029667
Gene: ENSMUSG00000028033
AA Change: D826E

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 1.7e-26 PFAM
Pfam:Ion_trans_2 272 352 5.3e-15 PFAM
Pfam:KCNQ_channel 446 648 3.6e-95 PFAM
low complexity region 848 858 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115300
AA Change: D845E

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110955
Gene: ENSMUSG00000028033
AA Change: D845E

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
Pfam:Ion_trans 126 359 4.1e-28 PFAM
Pfam:Ion_trans_2 272 352 3.3e-16 PFAM
Pfam:KCNQ_channel 467 661 1.8e-98 PFAM
low complexity region 867 877 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173058
AA Change: D716E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134166
Gene: ENSMUSG00000028033
AA Change: D716E

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 2e-26 PFAM
Pfam:Ion_trans_2 272 352 3.1e-15 PFAM
Pfam:KCNQ_channel 405 538 8e-64 PFAM
low complexity region 738 748 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173404
AA Change: D817E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134076
Gene: ENSMUSG00000028033
AA Change: D817E

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 2.4e-26 PFAM
Pfam:Ion_trans_2 272 352 3.6e-15 PFAM
Pfam:KCNQ_channel 437 639 2e-95 PFAM
low complexity region 839 849 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174183
SMART Domains Protein: ENSMUSP00000134389
Gene: ENSMUSG00000028033

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KCNQ potassium channel gene family that is differentially expressed in subregions of the brain and in skeletal muscle. The protein encoded by this gene yields currents that activate slowly with depolarization and can form heteromeric channels with the protein encoded by the KCNQ3 gene. Currents expressed from this protein have voltage dependences and inhibitor sensitivities in common with M-currents. They are also inhibited by M1 muscarinic receptor activation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a dominant negative knock-in mutation in this gene exhibit partial prenatal lethality and abnormal afterhyperpolarization in the in the CA3 area of hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,895,739 probably null Het
Arid3a A G 10: 79,950,769 E452G possibly damaging Het
Barhl2 A G 5: 106,457,640 S68P unknown Het
BC030499 T C 11: 78,292,747 F194L probably benign Het
Carf T C 1: 60,108,174 S17P probably damaging Het
Ccdc90b A G 7: 92,574,811 D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Daam2 A G 17: 49,494,391 I106T possibly damaging Het
Dmtf1 A G 5: 9,126,641 V437A probably benign Het
E2f2 A T 4: 136,184,440 Y254F possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Ern2 T C 7: 122,179,959 T221A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fermt1 A G 2: 132,941,963 V42A possibly damaging Het
Fgf3 A G 7: 144,842,810 D187G probably damaging Het
Flnb T A 14: 7,901,945 V936E probably damaging Het
Gm5415 A T 1: 32,545,648 C394S probably damaging Het
Herc2 T C 7: 56,122,351 Y1093H probably damaging Het
Invs A G 4: 48,283,242 probably benign Het
Katnb1 T A 8: 95,097,980 I534N possibly damaging Het
Klra9 A T 6: 130,188,712 N113K probably benign Het
Knl1 A G 2: 119,069,176 K453E probably damaging Het
Lgi4 C T 7: 31,070,757 probably benign Het
Lpin3 A G 2: 160,897,138 S289G probably benign Het
Mapre1 T A 2: 153,758,067 V137E possibly damaging Het
Mark4 A G 7: 19,447,243 F144L possibly damaging Het
Mogat2 G T 7: 99,223,635 A114E possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nell2 A G 15: 95,527,809 L19P possibly damaging Het
Nfia A T 4: 97,783,348 K98N probably damaging Het
Nutm1 T A 2: 112,249,000 T857S possibly damaging Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Olfr298 TG T 7: 86,489,291 probably null Het
Olfr68 T C 7: 103,777,404 K314E probably benign Het
Pde10a T C 17: 8,977,155 L706P probably damaging Het
Penk A G 4: 4,134,296 L117P probably damaging Het
Pgap1 A G 1: 54,481,856 S876P probably damaging Het
Pmfbp1 T C 8: 109,527,767 I478T possibly damaging Het
Pole G A 5: 110,294,934 E318K possibly damaging Het
Prr12 C A 7: 45,046,377 V1222L unknown Het
Prune2 T C 19: 17,216,357 S3070P possibly damaging Het
Rnf19a A G 15: 36,244,196 C573R probably benign Het
Rp1l1 T C 14: 64,030,180 S1072P probably damaging Het
Sh3pxd2a T C 19: 47,273,411 N315S possibly damaging Het
Snph T C 2: 151,594,544 I86V probably damaging Het
Sox6 A G 7: 115,777,228 Y90H probably damaging Het
Tbc1d13 T A 2: 30,142,311 C145S probably benign Het
Tcp11l1 T C 2: 104,699,944 E65G probably damaging Het
Thrb G T 14: 18,011,181 E186* probably null Het
Tmem101 A G 11: 102,156,233 Y38H possibly damaging Het
Tusc5 T A 11: 76,680,308 L50Q probably damaging Het
Urb1 A T 16: 90,783,274 probably null Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Usp25 A G 16: 77,109,227 E857G probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr35 T C 12: 9,018,142 L775P probably damaging Het
Xpnpep1 T C 19: 53,013,414 T134A probably benign Het
Zbtb10 T C 3: 9,264,671 V363A probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Kcnq5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Kcnq5 APN 1 21505763 missense probably damaging 1.00
IGL01603:Kcnq5 APN 1 21505340 missense possibly damaging 0.94
IGL02326:Kcnq5 APN 1 21402592 missense probably benign 0.17
IGL02624:Kcnq5 APN 1 21402430 missense probably benign 0.27
IGL03151:Kcnq5 APN 1 21535069 missense probably damaging 1.00
IGL03367:Kcnq5 APN 1 21403065 missense probably damaging 1.00
PIT1430001:Kcnq5 UTSW 1 21535181 missense probably damaging 1.00
R0705:Kcnq5 UTSW 1 21535177 missense probably damaging 1.00
R0798:Kcnq5 UTSW 1 21961175 splice site probably null
R1263:Kcnq5 UTSW 1 21479378 missense probably damaging 1.00
R1445:Kcnq5 UTSW 1 21405024 missense probably benign 0.01
R1465:Kcnq5 UTSW 1 21469468 critical splice donor site probably null
R1465:Kcnq5 UTSW 1 21469468 critical splice donor site probably null
R1497:Kcnq5 UTSW 1 21402386 missense possibly damaging 0.82
R1515:Kcnq5 UTSW 1 21402681 missense probably benign 0.01
R1610:Kcnq5 UTSW 1 21457461 missense probably damaging 1.00
R1835:Kcnq5 UTSW 1 21466387 missense probably benign 0.04
R1999:Kcnq5 UTSW 1 21402204 missense probably null 0.18
R2060:Kcnq5 UTSW 1 21461597 missense probably benign 0.06
R2145:Kcnq5 UTSW 1 21505349 missense probably damaging 0.96
R2314:Kcnq5 UTSW 1 21479371 splice site probably null
R2511:Kcnq5 UTSW 1 21505782 nonsense probably null
R2697:Kcnq5 UTSW 1 21479432 missense probably damaging 1.00
R2886:Kcnq5 UTSW 1 21469547 nonsense probably null
R2889:Kcnq5 UTSW 1 21402302 missense probably damaging 0.98
R4176:Kcnq5 UTSW 1 21535168 missense probably damaging 1.00
R4609:Kcnq5 UTSW 1 21405068 splice site probably null
R4720:Kcnq5 UTSW 1 21403050 missense probably damaging 0.96
R4904:Kcnq5 UTSW 1 21424100 missense probably damaging 0.98
R5268:Kcnq5 UTSW 1 21505725 missense probably damaging 1.00
R5373:Kcnq5 UTSW 1 21961571 missense unknown
R5397:Kcnq5 UTSW 1 21405856 missense probably damaging 1.00
R5473:Kcnq5 UTSW 1 21457402 critical splice donor site probably null
R5490:Kcnq5 UTSW 1 21479468 missense probably damaging 1.00
R5946:Kcnq5 UTSW 1 21505707 missense probably damaging 1.00
R6941:Kcnq5 UTSW 1 21405844 missense probably damaging 1.00
R6962:Kcnq5 UTSW 1 21505793 missense probably damaging 1.00
R7201:Kcnq5 UTSW 1 21402875 missense possibly damaging 0.93
R7238:Kcnq5 UTSW 1 21402302 missense probably benign 0.39
R7375:Kcnq5 UTSW 1 21469486 missense possibly damaging 0.82
R7584:Kcnq5 UTSW 1 21402321 missense probably benign
R7780:Kcnq5 UTSW 1 21961331 missense probably benign 0.43
R8043:Kcnq5 UTSW 1 21479420 missense probably damaging 1.00
Z1088:Kcnq5 UTSW 1 21457529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGTGCCGTCAAAAGTATC -3'
(R):5'- ATCAAGCACTTGTCCAGGC -3'

Sequencing Primer
(F):5'- GTGCCGTCAAAAGTATCTGTTTC -3'
(R):5'- TTGTCCAGGCCAGAACCTCTG -3'
Posted On2016-07-06